- Clone
- A12 (7D4) (See other available formats)
- Regulatory Status
- RUO
- Other Names
- SLAM, Signaling Lymphocyte Activation Molecule, IPO-3
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GTCATTGTATGTCTG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
306321 | 10 µg | $369 |
CD150 is a 70-95 kD type I transmembrane glycoprotein also known as SLAM or IPO-3. It is a member of the Ig superfamily. It is expressed on a subset of T cells, B cells, dendritic cells, and endothelial cells. The expression of CD150 is upregulated upon activation. CD150 binds to itself as the ligand to be involved in B cell costimulation, proliferation, immunoglobulin production, and signal transduction.
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green, Baboon
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Activated human PBMC
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections, immunoprecipitation4, and costimulation1,5 of IFN-gamma production and T cell proliferation. The Ultra-LEAF™ purified antibody (Endotoxin <0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 306317 and 306318).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Garcia V, et al. 2001. J. Immunol. 167:5719. (Costim)
- Vincent S, et al. 2002. J. Virol. 76:6121.
- Cocks B, et al. 1995. Nature 376:260.
- Sayos J, et al. 2001. Blood 97:3867. (IP)
- Aversa G, et al. 1997. J. Immunol. 158:4036. (Costim)
- Spencer M, et al. 2010. Am. J. Physiol Endocrinol Metab. 299:1016. PubMed
- RRID
-
AB_2941475 (BioLegend Cat. No. 306321)
Antigen Details
- Structure
- Ig superfamily, type I transmembrane glycoprotein, 70-95 kD
- Distribution
-
T subset (upregulated after activation), B cells, dendritic cells, endothelial cells
- Function
- B cell costimulation, proliferation and Ig production
- Ligand/Receptor
- CD150 (self ligand)
- Cell Type
- B cells, Dendritic cells, Endothelial cells, T cells, Tregs
- Biology Area
- Costimulatory Molecules, Immunology, Innate Immunity
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Cocks B, et al. 1995. Nature 376:260.
2. Pinchouk V, et al. 1988. AntiCancer Res. 8:1377.
3. Polacino P, et al. 1996. J. Med. Primatol. 25:201.
4. Punnonen J, et al. 1997. J. Exp. Med. 185:993. - Gene ID
- 6504 View all products for this Gene ID
- UniProt
- View information about CD150 on UniProt.org
Related FAQs
Other Formats
View All CD150 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
FITC anti-human CD150 (SLAM) | A12 (7D4) | FC |
PE anti-human CD150 (SLAM) | A12 (7D4) | FC |
Purified anti-human CD150 (SLAM) | A12 (7D4) | FC,IHC-F,Costim,IP |
Alexa Fluor® 488 anti-human CD150 (SLAM) | A12 (7D4) | FC |
TotalSeq™-A0870 anti-human CD150 (SLAM) | A12 (7D4) | PG |
TotalSeq™-C0870 anti-human CD150 (SLAM) | A12 (7D4) | PG |
Ultra-LEAF™ Purified anti-human CD150 (SLAM) | A12 (7D4) | FC |
TotalSeq™-B0870 anti-human CD150 (SLAM) Antibody | A12 (7D4) | PG |
TotalSeq™-D0870 anti-human CD150 (SLAM) | A12 (7D4) | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD150 (SLAM)
-
PE anti-human CD150 (SLAM)
-
Purified anti-human CD150 (SLAM)
-
Alexa Fluor® 488 anti-human CD150 (SLAM)
-
TotalSeq™-A0870 anti-human CD150 (SLAM)
-
TotalSeq™-C0870 anti-human CD150 (SLAM)
-
Ultra-LEAF™ Purified anti-human CD150 (SLAM)
-
TotalSeq™-B0870 anti-human CD150 (SLAM) Antibody
-
TotalSeq™-D0870 anti-human CD150 (SLAM)
Follow Us