- Clone
- RM4-5 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- L3T4, T4
- Isotype
- Rat IgG2a, κ
- Barcode Sequence
- AACAAGACCCTTGAG
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
100569 | 10 µg | $369.00 |
CD4 is a 55 kD protein also known as L3T4 or T4. It is a member of the Ig superfamily, primarily expressed on most thymocytes and a subset of T cells, and weakly on macrophages and dendritic cells. It acts as a co-receptor with the TCR during T cell activation and thymic differentiation by binding MHC class II and associating with the protein tyrosine kinase lck.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- BALB/c mouse thymocytes
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The RM4-5 antibody blocks the binding of GK1.5 antibody and H129.19 antibody to CD4+ T cells, but not RM4-4 antibody. Additional reported applications (for the relevant formats) include: blocking of ligand binding, in vivo depletion of CD4+ cells1, and immunohistochemistry of acetone-fixed frozen tissue sections2,3,11 and paraffin-embedded sections11. Clone RM4-5 is not recommended for immunohistochemistry of formalin-fixed paraffin sections. Instead, acetone frozen or zinc-fixed paraffin sections are recommended. The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 100575 and 100576).
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Kruisbeek AM. 1991. In Curr. Protocols Immunol. pp. 4.1.1-4.1.5. (Block, Deplete)
- Nitta H, et al. 1997. Cell Vision 4:73. (IHC)
- Fan WY, et al. 2001. Exp. Biol. Med. 226:1045.
- Muraille E, et al. 2003. Infect. Immun. 71:2704. (IHC)
- León-Ponte M, et al. 2007. Blood 109:3139. (FC)
- Bourdeau A, et al. 2007. Blood doi:10.1182/blood-2006-08-044370. (FC)
- Matsumoto M, et al. 2007.J. Immunol.178:2499. PubMed
- Shigeta A, et al. 2008. Blood 112:4915. PubMed
- Zaborsky N, et al. 2010. J. Immunol. 184:725. PubMed
- Rodrigues-Manzanet R, et al. 2010. P. Natl Acad Sci USA 107:8706. PubMed
- Whiteland JL, et al. 1995. J. Histochem. Cytochem. 43:313. (IHC)
- Product Citations
-
- RRID
-
AB_2749956 (BioLegend Cat. No. 100569)
Antigen Details
- Structure
- Ig superfamily, 55 kD
- Distribution
-
Majority of thymocytes, T cell subset
- Function
- TCR co-receptor, T cell activation
- Ligand/Receptor
- MHC class II molecule
- Cell Type
- Dendritic cells, T cells, Thymocytes, Tregs
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Bierer BE, et al. 1989. Annu. Rev. Immunol. 7:579.
3. Janeway CA. 1992. Annu. Rev. Immunol. 10:645. - Gene ID
- 12504 View all products for this Gene ID
- UniProt
- View information about CD4 on UniProt.org
Other Formats
View All CD4 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-mouse CD4
-
Biotin anti-mouse CD4
-
FITC anti-mouse CD4
-
PE anti-mouse CD4
-
PE/Cyanine5 anti-mouse CD4
-
Purified anti-mouse CD4
-
PE/Cyanine7 anti-mouse CD4
-
APC/Cyanine7 anti-mouse CD4
-
Alexa Fluor® 647 anti-mouse CD4
-
Alexa Fluor® 488 anti-mouse CD4
-
Pacific Blue™ anti-mouse CD4
-
Alexa Fluor® 700 anti-mouse CD4
-
PerCP anti-mouse CD4
-
PerCP/Cyanine5.5 anti-mouse CD4
-
Brilliant Violet 421™ anti-mouse CD4
-
APC/Fire™ 750 anti-mouse CD4
-
Brilliant Violet 570™ anti-mouse CD4
-
Brilliant Violet 605™ anti-mouse CD4
-
Brilliant Violet 650™ anti-mouse CD4
-
Brilliant Violet 711™ anti-mouse CD4
-
Brilliant Violet 785™ anti-mouse CD4
-
Brilliant Violet 510™ anti-mouse CD4
-
Purified anti-mouse CD4 (Maxpar® Ready)
-
PE/Dazzle™ 594 anti-mouse CD4
-
TotalSeq™-A0001 anti-mouse CD4
-
TotalSeq™-B0001 anti-mouse CD4
-
TotalSeq™-C0001 anti-mouse CD4
-
Ultra-LEAF™ Purified anti-mouse CD4
-
Spark Violet™ 423 anti-mouse CD4 (L3T4) Antibody
-
Spark Red™ 718 anti-mouse CD4 (L3T4) (Flexi-Fluor™)