TotalSeq™-A0049 anti-human CD3 Antibody

Pricing & Availability
Clone
SK7 (See other available formats)
Regulatory Status
RUO
Workshop
HCDM listed
Other Names
T3, CD3ε
Isotype
Mouse IgG1, κ
Barcode Sequence
TATCCCTTGGGATGG
Cat # Size Price Quantity Check Availability
344847 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD3ε is a 20 kD chain of the CD3/T-cell receptor (TCR) complex, which is composed of two CD3ε, one CD3γ, one CD3δ, one CD3ζ (CD247), and a T-cell receptor (α/β or γ/δ) heterodimer. It is found on all mature T cells, NK T cells, and some thymocytes. CD3, also known as T3, is a member of the immunoglobulin superfamily that plays a role in antigen recognition, signal transduction, and T cell activation.

Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported application (for the relevant formats) include: immunohistochemical staining of frozen tissue sections4,5,8, immunofluorescent staining6, and Western blotting3.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Kan EA, et al. 1983. J. Immunol. 131:536.
  2. Wood GS, et al. 1985. Am. J. Pathol. 120:371.
  3. Van Dongen JJM, et al. 1988. Blood 71:603. (WB)
  4. Haringman JJ, et al. 2005. Arthritis Res. Ther. 7:R862. (IHC)
  5. Carbone A, et al. 1999. Blood 93:2319. (IHC)
  6. Goval JJ, et al. 2006. J. Histochem. Cytochem. 54:75. (IF)
  7. Rutjens E, et al. 2007. J. Immunol. 178:1702.
  8. Kap Y, et al. 2009. J. Histochem. Cytochem. 57:1159. (IHC)
  9. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
Product Citations
  1. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2734353 (BioLegend Cat. No. 344847)

Antigen Details

Structure
Ig superfamily, with the subunits of CD3γ, CD3δ, CD3ζ, (CD247) and TCR (α/β or γ/δ) forms CD3/TCR complex, 20 kD
Distribution

Mature T and NK T cells, during thymocyte differentiation

Function
Antigen recognition, signal transduction, T cell activation
Ligand/Receptor
Peptide antigen bound to MHC
Cell Type
NKT cells, T cells, Tregs
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, TCRs
Antigen References

1. Barclay N, et al. 1993. The Leucocyte FactsBook. Academic Press. San Diego.
2. Beverly P, et al. 1981. Eur. J. Immunol. 11:329.
3. Lanier L, et al. 1986. J. Immunol. 137:2501.

Gene ID
916 View all products for this Gene ID
UniProt
View information about CD3 on UniProt.org

Other Formats

View All CD3 Reagents Request Custom Conjugation
Description Clone Applications
APC/Fire™ 750 anti-human CD3 SK7 FC
Biotin anti-human CD3 SK7 FC,ICC
Purified anti-human CD3 SK7 FC,ICC,IHC-F,WB
FITC anti-human CD3 SK7 FC
PE anti-human CD3 SK7 FC
Alexa Fluor® 488 anti-human CD3 SK7 FC
APC anti-human CD3 SK7 FC
PerCP/Cyanine5.5 anti-human CD3 SK7 FC
PerCP anti-human CD3 SK7 FC
PE/Cyanine7 anti-human CD3 SK7 FC
APC/Cyanine7 anti-human CD3 SK7 FC
Alexa Fluor® 700 anti-human CD3 SK7 FC
Pacific Blue™ anti-human CD3 SK7 FC
Alexa Fluor® 647 anti-human CD3 SK7 FC
Brilliant Violet 510™ anti-human CD3 SK7 FC
Brilliant Violet 421™ anti-human CD3 SK7 FC
Brilliant Violet 605™ anti-human CD3 SK7 FC
Brilliant Violet 711™ anti-human CD3 SK7 FC
FITC anti-human CD3 SK7 FC
PE anti-human CD3 SK7 FC
Brilliant Violet 785™ anti-human CD3 SK7 FC
PE/Dazzle™ 594 anti-human CD3 SK7 FC
Brilliant Violet 750™ anti-human CD3 SK7 FC
TotalSeq™-A0049 anti-human CD3 SK7 PG
PerCP/Cyanine5.5 anti-human CD3 SK7 FC
TotalSeq™-C0049 anti-human CD3 SK7 PG
Spark Blue™ 550 anti-human CD3 SK7 FC
PE/Cyanine7 anti-human CD3 SK7 FC
TotalSeq™-B0049 anti-human CD3 SK7 PG
Alexa Fluor® 660 anti-human CD3 SK7 FC
APC/Fire™ 810 anti-human CD3 SK7 FC
Spark NIR™ 685 anti-human CD3 SK7 FC
PE/Fire™ 640 anti-human CD3 SK7 FC
PE/Fire™ 700 anti-human CD3 SK7 FC
APC anti-human CD3 SK7 FC
PerCP anti-human CD3 SK7 FC
APC/Fire™ 750 anti-human CD3 SK7 FC
GMP FITC anti-human CD3 SK7 FC
PE/Cyanine5 anti-human CD3 Antibody SK7 FC
GMP PE anti-human CD3 SK7 FC
GMP APC anti-human CD3 SK7 FC
GMP PerCP/Cyanine5.5 anti-human CD3 SK7 FC
Spark YG™ 593 anti-human CD3 SK7 FC
GMP PerCP anti-human CD3 SK7 FC
Spark Violet™ 500 anti-human CD3 SK7 FC
Brilliant Violet 650™ anti-human CD3 SK7 FC
Spark Violet™ 500 anti-human CD3 SK7 FC
Spark PLUS UV395™ anti-human CD3 SK7 FC
Go To Top Version: 1    Revision Date: 05/30/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account