TotalSeq™-A0096 anti-mouse CD45 Antibody

Pricing & Availability
Clone
30-F11 (See other available formats)
Regulatory Status
RUO
Other Names
T200, Ly-5, LCA
Isotype
Rat IgG2b, κ
Barcode Sequence
TGGCTATGGAGCAGA
Cat # Size Price Quantity Check Availability
103159 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD45 is a 180-240 kD glycoprotein also known as the leukocyte common antigen (LCA), T200, or Ly-5. It is a member of the protein tyrosine phosphatase (PTP) family, expressed on all hematopoietic cells except mature erythrocytes and platelets. There are different isoforms of CD45 that arise from variable splicing of exons 4, 5, and 6, which encode A, B, and C determinants, respectively. CD45 plays a key role in TCR and BCR signal transduction. These isoforms are very specific to the activation and maturation state of the cell as well as cell type. The primary ligands for CD45 are galectin-1, CD2, CD3, CD4, TCR, CD22, and Thy-1.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse thymus or spleen
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone 30-F11 reacts with all isoforms and both CD45.1 and CD45.2 alloantigens of CD45.

Additional reported applications (for relevant formats) include: immunoprecipitation3, complement-dependent cytotoxicity1,5, immunohistochemistry (acetone-fixed frozen sections, zinc-fixed paraffin-embedded sections and formalin-fixed paraffin-embedded sections)4,6, Western blotting7, and spatial biology (IBEX)10,11. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 103163 and 103164).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Podd BS, et al. 2006. J. Immunol. 176:6532. (FC, CMCD) PubMed
  2. Haynes NM, et al. 2007. J. Immunol. 179:5099. (FC)
  3. Ledbetter JA, et al. 1979. Immunol. Rev. 47:63. (IP)
  4. Simon DI, et al. 2000. J. Clin. Invest. 105:293. (IHC)
  5. Seaman WE. 1983. J. Immunol. 130:1713. (CMCD)
  6. Cornet A, et al. 2001. P. Natl. Acad. Sci. USA 98:13306. (IHC)
  7. Tsuboi S and Fukuda M. 1998. J. Biol. Chem. 273:30680. (WB) PubMed
  8. Liu F, et al. 2012. Blood. 119:3295. PubMed
  9. Pelletier AN, et al. 2012. J. Immunol. 188:5561. PubMed
  10. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  11. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
Product Citations
  1. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  2. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  3. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
RRID
AB_2734156 (BioLegend Cat. No. 103159)

Antigen Details

Structure
Protein tyrosine phosphatase (PTP) family, 180-240 kD
Distribution

All hematopoietic cells except mature erythrocytes and platelets

Function
Phosphatase, T and B cell activation
Ligand/Receptor
Galectin-1, CD2, CD3, CD4, TCR, CD22, Thy-1
Cell Type
B cells, Dendritic cells, Mesenchymal Stem Cells, Tregs
Biology Area
Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules
Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Trowbridge IS, et al. 1993. Annu. Rev. Immunol. 12:85.
3. Kishihara K, et al. 1993. Cell 74:143.
4. Pulido R, et al. 1988. J. Immunol. 140:3851.

Gene ID
19264 View all products for this Gene ID
UniProt
View information about CD45 on UniProt.org

Other Formats

View All CD45 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-mouse CD45 30-F11 FC
Biotin anti-mouse CD45 30-F11 FC
FITC anti-mouse CD45 30-F11 FC
PE anti-mouse CD45 30-F11 FC
PE/Cyanine5 anti-mouse CD45 30-F11 FC
Purified anti-mouse CD45 30-F11 FC,IHC-F,CyTOF®,IP,CMCD,IHC,WB
PE/Cyanine7 anti-mouse CD45 30-F11 FC
APC/Cyanine7 anti-mouse CD45 30-F11 FC
Alexa Fluor® 488 anti-mouse CD45 30-F11 FC,SB
Alexa Fluor® 647 anti-mouse CD45 30-F11 FC,ICC,IHC,3D IHC,SB
Pacific Blue™ anti-mouse CD45 30-F11 FC
Alexa Fluor® 700 anti-mouse CD45 30-F11 FC,SB
PerCP/Cyanine5.5 anti-mouse CD45 30-F11 FC
PerCP anti-mouse CD45 30-F11 FC
Alexa Fluor® 594 anti-mouse CD45 30-F11 IHC-F,FC,3D IHC
Brilliant Violet 421™ anti-mouse CD45 30-F11 FC,SB
Brilliant Violet 570™ anti-mouse CD45 30-F11 FC
Brilliant Violet 510™ anti-mouse CD45 30-F11 FC
Brilliant Violet 605™ anti-mouse CD45 30-F11 FC
Purified anti-mouse CD45 (Maxpar® Ready) 30-F11 FC,CyTOF®
PE/Dazzle™ 594 anti-mouse CD45 30-F11 FC
Brilliant Violet 711™ anti-mouse CD45 30-F11 FC
Brilliant Violet 785™ anti-mouse CD45 30-F11 FC
Brilliant Violet 650™ anti-mouse CD45 30-F11 FC
APC/Fire™ 750 anti-mouse CD45 30-F11 FC
Brilliant Violet 750™ anti-mouse CD45 30-F11 FC
TotalSeq™-A0096 anti-mouse CD45 30-F11 PG
TotalSeq™-B0096 anti-mouse CD45 30-F11 PG
Ultra-LEAF™ Purified anti-mouse CD45 30-F11 FC,CyTOF®,IP,CMCD,IHC,WB
Spark Blue™ 550 anti-mouse CD45 30-F11 FC
Spark NIR™ 685 anti-mouse CD45 30-F11 FC
TotalSeq™-C0096 anti-mouse CD45 30-F11 PG
Spark YG™ 570 anti-mouse CD45 30-F11 IHC-F
PE/Fire™ 640 anti-mouse CD45 30-F11 FC
APC/Fire™ 810 anti-mouse CD45 30-F11 FC
PE/Fire™ 700 anti-mouse CD45 30-F11 FC
Spark Violet™ 538 anti-mouse CD45 30-F11 FC
Spark YG™ 593 anti-mouse CD45 30-F11 FC
Spark Blue™ 574 anti-mouse CD45 Antibody 30-F11 FC
Spark Blue™ 515 anti-mouse CD45 30-F11 FC
Spark UV™ 387 anti-mouse CD45 30-F11 FC
PE/Fire™ 810 anti-mouse CD45 30-F11 FC
Spark Red™ 718 anti-mouse CD45 (Flexi-Fluor™) 30-F11 FC
Spark PLUS UV395™ anti-mouse CD45 30-F11 FC
Go To Top Version: 1    Revision Date: 05/29/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account