- Clone
- MHM-88 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Immunoglobulin M
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TAGCGAGCCCGTATA
| Cat # | Size | Price | Quantity Check Availability | ||
|---|---|---|---|---|---|
| 314541 | 10 µg | $369.00 | |||
IgM is the first immunoglobulin made by B cells in the immune response. Surface IgM is expressed on immature and mature B cells, while IgM heavy (μ) chain is expressed intracellularly in pre-B cells.
Product Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human Ig cocktail
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
MHM-88 antibody reacts with both soluble and membrane human immunoglobulin M (IgM). It does not react with other Ig isotypes. Additional reported applications (for the relevant formats) include: use as a primary or secondary reagent for ELISA analysis.
Due to the presence of excess soluble IgM in whole blood, which competes for antibody binding, staining for IgM on cells in whole blood is not recommended. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Perez-Shiyama C, et al. 2014. J Immunol. 192:5192. PubMed
- Product Citations
-
- RRID
-
AB_2749992 (BioLegend Cat. No. 314541)
Antigen Details
- Structure
- Ig family
- Distribution
-
B cells
- Function
- B cell differentiation, humoral immune response; cross-linking surface IgM induces apoptosis
- Cell Type
- B cells
- Biology Area
- Immunology
- Gene ID
- 3507 View all products for this Gene ID
- UniProt
- View information about IgM on UniProt.org
Other Formats
View All IgM Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human IgM
Over night cultured human peripheral blood lymphocytes stain... -
PE anti-human IgM
Human peripheral blood lymphocytes were stained with CD19 FI... 
-
Biotin anti-human IgM
Human peripheral blood lymphocytes stained with CD19 APC and... -
FITC anti-human IgM
Human peripheral blood lymphocytes stained with MHM-88 FITC -
APC anti-human IgM
Human peripheral blood lymphocytes stained with MHM-88 APC -
PerCP/Cyanine5.5 anti-human IgM
Overnight cultured human peripheral blood lymphocytes were s... -
Pacific Blue™ anti-human IgM
Over night cultured human peripheral blood lymphocytes stain... 
-
Brilliant Violet 421™ anti-human IgM
-
APC/Cyanine7 anti-human IgM
Human peripheral blood lymphocytes were cultured overnight a... -
Brilliant Violet 570™ anti-human IgM
Isolated human peripheral blood mononuclear cells were stain... 
-
Brilliant Violet 510™ anti-human IgM
Isolated human peripheral blood mononuclear cells were stain... -
Brilliant Violet 605™ anti-human IgM
Overnight cultured human peripheral blood mononuclear cells ... 
-
Brilliant Violet 650™ anti-human IgM
Overnight cultured human peripheral blood mononuclear cells ... 
-
Purified anti-human IgM (Maxpar® Ready)
Human PBMCs stained with 142Nd-anti-CD19 (HIB19) and 172Yb-a... -
PE/Dazzle™ 594 anti-human IgM
Overnight cultured human peripheral blood mononuclear cells ... 
-
PE/Cyanine7 anti-human IgM
Overnight cultured human peripheral blood mononuclear cells ... -
Alexa Fluor® 488 anti-human IgM
Overnight cultured human peripheral blood mononuclear cells ... 
-
Alexa Fluor® 647 anti-human IgM
Overnight cultured human peripheral blood mononuclear cells ... 
-
Alexa Fluor® 700 anti-human IgM
Overnight cultured human peripheral blood mononuclear cells ... 
-
Brilliant Violet 711™ anti-human IgM
Isolated human peripheral blood mononuclear cells were stain... 
-
TotalSeq™-A0136 anti-human IgM
-
TotalSeq™-C0136 anti-human IgM
-
Brilliant Violet 785™ anti-human IgM
Human peripheral blood lymphocytes were cultured overnight a... -
APC/Fire™ 750 anti-human IgM
Human peripheral blood lymphocytes were cultured overnight a... -
TotalSeq™-B0136 anti-human IgM
-
Spark Violet™ 423 anti-human IgM Antibody
Overnight cultured human peripheral blood lymphocytes were s... -
TotalSeq™-D0136 anti-human IgM
-
Spark Blue™ 550 anti-human IgM
Human peripheral blood lymphocytes were cultured overnight a... -
Spark Blue™ 515 anti-human IgM
Overnight cultured human peripheral blood mononuclear cells ... -
PE/Fire™ 700 anti-human IgM
Overnight cultured human peripheral blood mononuclear cells ... -
Spark YG™ 593 anti-human IgM
Overnight cultured human peripheral blood lymphocytes staine... -
PE/Fire™ 640 anti-human IgM
Human peripheral blood mononuclear cells were stained with a... -
Spark Red™ 718 anti-human IgM (Flexi-Fluor™)
-
APC anti-human IgM
Typical results from overnight cultured human peripheral blo... -
PE anti-human IgM
Typical results from overnight cultured human peripheral blo... -
Brilliant Violet 750™ anti-human IgM
Overnight cultured human peripheral blood mononuclear cells ...