TotalSeq™-A0136 anti-human IgM Antibody

Pricing & Availability
Clone
MHM-88 (See other available formats)
Regulatory Status
RUO
Other Names
Immunoglobulin M
Isotype
Mouse IgG1, κ
Barcode Sequence
TAGCGAGCCCGTATA
Cat # Size Price Quantity Check Availability
314541 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

IgM is the first immunoglobulin made by B cells in the immune response. Surface IgM is expressed on immature and mature B cells, while IgM heavy (μ) chain is expressed intracellularly in pre-B cells.

Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human Ig cocktail
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

MHM-88 antibody reacts with both soluble and membrane human immunoglobulin M (IgM). It does not react with other Ig isotypes. Additional reported applications (for the relevant formats) include: use as a primary or secondary reagent for ELISA analysis.

Due to the presence of excess soluble IgM in whole blood, which competes for antibody binding, staining for IgM on cells in whole blood is not recommended.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Perez-Shiyama C, et al. 2014. J Immunol. 192:5192. PubMed
Product Citations
  1. Witkowski MT, et al. 2020. Cancer Cell. 37:867. PubMed
  2. Swanson E, et al. 2021. eLife. 10:00. PubMed
  3. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2749992 (BioLegend Cat. No. 314541)

Antigen Details

Structure
Ig family
Distribution

B cells

Function
B cell differentiation, humoral immune response; cross-linking surface IgM induces apoptosis
Cell Type
B cells
Biology Area
Immunology
Gene ID
3507 View all products for this Gene ID
UniProt
View information about IgM on UniProt.org

Other Formats

View All IgM Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human IgM MHM-88 FC,ELISA
PE anti-human IgM MHM-88 FC
Biotin anti-human IgM MHM-88 FC,ELISA
FITC anti-human IgM MHM-88 FC
APC anti-human IgM MHM-88 FC
PerCP/Cyanine5.5 anti-human IgM MHM-88 FC
Pacific Blue™ anti-human IgM MHM-88 FC
Brilliant Violet 421™ anti-human IgM MHM-88 FC
APC/Cyanine7 anti-human IgM MHM-88 FC
Brilliant Violet 570™ anti-human IgM MHM-88 FC
Brilliant Violet 510™ anti-human IgM MHM-88 FC
Brilliant Violet 605™ anti-human IgM MHM-88 FC
Brilliant Violet 650™ anti-human IgM MHM-88 FC
Purified anti-human IgM (Maxpar® Ready) MHM-88 FC,CyTOF®
PE/Dazzle™ 594 anti-human IgM MHM-88 FC
PE/Cyanine7 anti-human IgM MHM-88 FC
Alexa Fluor® 488 anti-human IgM MHM-88 FC
Alexa Fluor® 647 anti-human IgM MHM-88 FC
Alexa Fluor® 700 anti-human IgM MHM-88 FC
Brilliant Violet 711™ anti-human IgM MHM-88 FC
TotalSeq™-A0136 anti-human IgM MHM-88 PG
TotalSeq™-C0136 anti-human IgM MHM-88 PG
Brilliant Violet 785™ anti-human IgM MHM-88 FC
APC/Fire™ 750 anti-human IgM MHM-88 FC
TotalSeq™-B0136 anti-human IgM MHM-88 PG
Spark Violet™ 423 anti-human IgM Antibody MHM-88 FC
TotalSeq™-D0136 anti-human IgM MHM-88 PG
Spark Blue™ 550 anti-human IgM MHM-88 FC
Spark Blue™ 515 anti-human IgM MHM-88 FC
PE/Fire™ 700 anti-human IgM MHM-88 FC
Spark YG™ 593 anti-human IgM MHM-88 FC
PE/Fire™ 640 anti-human IgM MHM-88 FC
Spark Red™ 718 anti-human IgM (Flexi-Fluor™) MHM-88 FC
APC anti-human IgM MHM-88 FC
PE anti-human IgM MHM-88 FC
Brilliant Violet 750™ anti-human IgM MHM-88 FC
Go To Top Version: 1    Revision Date: 07/12/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account