TotalSeq™-A0182 anti-mouse CD3 Antibody

Pricing & Availability
Clone
17A2 (See other available formats)
Regulatory Status
RUO
Other Names
T cell antigen receptor complex, T3
Isotype
Rat IgG2b, κ
Barcode Sequence
GTATGTCCGCTCGAT
Cat # Size Price Quantity Check Availability
100251 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD3, also known as T3, is a member of the Ig superfamily and primarily expressed on T cells, NK-T cells, and at different levels on thymocytes during T cell differentiation. CD3 is composed of CD3ε, δ, γ and ζ chains. It forms a TCR complex by associating with TCR α/β or γ/δ chains. CD3 plays a critical role in TCR signal transduction, T cell activation, and antigen recognition by binding the peptide/MHC antigen complex

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
γδTCR-positive T-T hybridoma D1
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported application (for relevant formats) include: spatial biology (IBEX)1,2.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  2. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
Product Citations
  1. Kedmi R, et al. 2022. Nature. 610:737. PubMed
  2. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  3. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  4. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  5. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
  6. Pisu D, et al. 2021. J Exp Med. 218:. PubMed
RRID
AB_2750533 (BioLegend Cat. No. 100251)

Antigen Details

Structure
Ig superfamily, CD3/TCR, 20 kD
Distribution

Thymocytes (differentiation dependent), mature T cells, NK-T cells

Function
Antigen recognition, TCR signal transduction, T cell activation
Ligand/Receptor
Peptide antigen/MHC-complex
Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Davis MM. 1990. Annu. Rev. Biochem. 59:475.
3. Weiss A, et al. 1994. Cell 76:263.

Gene ID
12502 View all products for this Gene ID
UniProt
View information about CD3 on UniProt.org

Other Formats

View All CD3 Reagents Request Custom Conjugation
Description Clone Applications
FITC anti-mouse CD3 17A2 FC
PE anti-mouse CD3 17A2 FC
Purified anti-mouse CD3 17A2 FC,IHC-F,IP,ICC
Alexa Fluor® 647 anti-mouse CD3 17A2 FC,IHC-F,3D IHC,SB
Alexa Fluor® 488 anti-mouse CD3 17A2 FC,IHC-F,3D IHC
Pacific Blue™ anti-mouse CD3 17A2 FC
Alexa Fluor® 700 anti-mouse CD3 17A2 FC
PerCP/Cyanine5.5 anti-mouse CD3 17A2 FC
PE/Cyanine7 anti-mouse CD3 17A2 FC
APC/Cyanine7 anti-mouse CD3 17A2 FC
Brilliant Violet 421™ anti-mouse CD3 17A2 FC,ICC
Brilliant Violet 570™ anti-mouse CD3 17A2 FC
Brilliant Violet 650™ anti-mouse CD3 17A2 FC
Brilliant Violet 785™ anti-mouse CD3 17A2 FC
Brilliant Violet 510™ anti-mouse CD3 17A2 FC
APC anti-mouse CD3 17A2 FC
Ultra-LEAF™ Purified anti-mouse CD3 17A2 FC,IHC-F,IP,ICC
Brilliant Violet 605™ anti-mouse CD3 17A2 FC
Alexa Fluor® 594 anti-mouse CD3 17A2 IHC-F,FC,3D IHC,SB
Brilliant Violet 711™ anti-mouse CD3 17A2 FC
Biotin anti-mouse CD3 17A2 FC,IHC-F
PE/Dazzle™ 594 anti-mouse CD3 17A2 FC
APC/Fire™ 750 anti-mouse CD3 17A2 FC
Brilliant Violet 750™ anti-mouse CD3 17A2 FC
TotalSeq™-A0182 anti-mouse CD3 17A2 PG
TotalSeq™-B0182 anti-mouse CD3 17A2 PG
Spark Blue™ 550 anti-mouse CD3 17A2 FC
Spark NIR™ 685 anti-mouse CD3 17A2 FC
TotalSeq™-C0182 anti-mouse CD3 17A2 PG
APC/Fire™ 810 anti-mouse CD3 17A2 FC
PE/Fire™ 640 anti-mouse CD3 17A2 FC
Spark YG™ 570 anti-mouse CD3 17A2 IHC-F
PE/Fire™ 700 anti-mouse CD3 17A2 FC
PE/Cyanine5 anti-mouse CD3 17A2 FC
Spark Blue™ 574 anti-mouse CD3 Antibody 17A2 FC
Spark Violet™ 423 anti-mouse CD3 17A2 FC
PE/Fire™ 810 anti-mouse CD3 17A2 FC
Spark Red™ 718 anti-mouse CD3 17A2 FC
Spark UV™ 387 anti-mouse CD3 17A2 FC
Go To Top Version: 1    Revision Date: 08/31/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account