TotalSeq™-A0198 anti-mouse CD127 (IL-7Rα) Antibody

Pricing & Availability
Clone
A7R34 (See other available formats)
Regulatory Status
RUO
Other Names
IL-7 receptor α chain, IL-7Rα
Isotype
Rat IgG2a, κ
Barcode Sequence
GTGTGAGGCACTCTT
Compare all formats
Cat # Size Price Quantity Check Availability
135045 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD127 is a 60-90 kD type I transmembrane glycoprotein also known as IL-7 receptor α chain or IL-7Rα. It forms a heterodimer with the common γ chain (γc or CD132) which is shared with the receptors for IL-2, IL-4, IL-9, IL-13, IL-15, and IL-21. CD127 is expressed on immature B cells through early pre-B stage, thymocytes (except CD4/CD8 double positive thymocytes), peripheral T cells, and bone marrow stromal cells. CD127 has been reported to be an useful marker for identifying memory and effector T cells. The ligation of IL-7 with its receptor is important for stimulation of mature and immature T cells as well as immature B cells proliferation and development.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
IL-7Ra-IgG1 fusion protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

A7R34 is able to block clone SB/199 binding to IL-7R.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Sudo T, et al. 1993. P. Natl. Acad. Sci. USA 90:9125.
  2. Hashi H, et al. 2001. J. Immunol. 166:3702.
  3. Taylor R, et al. 2007. J. Immunol. 178:5659.
  4. Mazzon C, et al. 2011. Blood. 118:2733. PubMed
  5. Jin J, et al. 2011. J. Immunol. doi:10.4049/jimmunol.1001238. PubMed
Product Citations
  1. Lin YH 2023. Immunity. 56(1):207-223.e8. PubMed
  2. Kedmi R, et al. 2022. Nature. 610:737. PubMed
  3. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  4. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  5. Sun Y, et al. 2020. J Immunol. 205:2649. PubMed
RRID
AB_2750009 (BioLegend Cat. No. 135045)

Antigen Details

Structure
Type I transmembrane glycoprotein, associate with CD132, 60-90 kD
Distribution

Immature B cells through early pre-B stage, thymocytes (except CD4/CD8 double positive thymocytes), peripheral T cells, bone marrow stromal cells

Function
T cell and immature B cell proliferation and development
Ligand/Receptor
IL-7
Cell Type
B cells, T cells, Thymocytes
Biology Area
Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Sudo T, et al. 1993. P. Natl. Acad. Sci. USA 90:9125.
2. Okuno Y, et al. 2001. P. Natl. Acad. Sci. USA 99:6246.
3. Pillai M, et al. 2004. Leukemia Lymphoma 45:2403.

Gene ID
16197 View all products for this Gene ID
UniProt
View information about CD127 on UniProt.org
Go To Top Version: 1    Revision Date: 07/12/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account