- Clone
- MEM-166 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- Neutrophil specific antigen 1, NB1, polycythemia rubra vera 1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AGTATGGAGCCATAT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
315811 | 10 µg | $369.00 |
CD177 is also known as neutrophil specific antigen 1, NB1, and polycythemia rubra vera 1. It is a member of the uPAR family and is a GPI-linked cell surface glycoprotein with a molecular weight of 60 kD. CD177 is expressed on granulocytes and bone marrow progenitors (early erythroblasts, megakaryocytes). It is thought to be involved in allogeneic and autoimmune responses to neutrophils.
Product Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human granulocytes
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunoprecipitation, Western blotting5, and immunofluorescence4.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) - Product Citations
-
- RRID
-
AB_2750554 (BioLegend Cat. No. 315811)
Antigen Details
- Structure
- uPAR family, GPI-linked cell surface glycoprotein, 60 kD
- Distribution
-
Granulocytes, bone marrow progenitors (early erythroblasts, megakaryocytes)
- Function
- Antigen involved in neutrophil allo- and autoimmunity, function unknown
- Modification
- Glycosylated
- Cell Type
- Granulocytes, Hematopoietic stem and progenitors, Neutrophils
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Leukocyte Typing VII. Mason D, et al. (Eds.) Oxford University Press (2002)
2. Kissel K, et al. 2001. Eur. J. Immunol. 31:1301.
3. Lalezari P, et al. 1971. J. Clin. Invest. 50:1108.
4. Temerinac S, et al. 2000. Blood 95:2569. - Gene ID
- 57126 View all products for this Gene ID
- UniProt
- View information about CD177 on UniProt.org
Other Formats
View All CD177 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD177 | MEM-166 | FC,ICC,IP,WB |
FITC anti-human CD177 | MEM-166 | FC |
PE anti-human CD177 | MEM-166 | FC |
APC anti-human CD177 | MEM-166 | FC |
APC/Cyanine7 anti-human CD177 | MEM-166 | FC |
TotalSeq™-A0382 anti-human CD177 | MEM-166 | PG |
TotalSeq™-C0382 anti-human CD177 | MEM-166 | PG |
TotalSeq™-B0382 anti-human CD177 | MEM-166 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.