TotalSeq™-A0444 anti-mouse CD184 (CXCR4) Antibody

Pricing & Availability
Clone
L276F12 (See other available formats)
Regulatory Status
RUO
Other Names
Fusin, LESTR, Sdf1r, Cmkar4, PB-CKR, PBSF/SDF-1
Isotype
Rat IgG2b, κ
Barcode Sequence
GTCGTGGTGTTGTTC
Cat # Size Price Quantity Check Availability
146520 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD184, also known as CXCR4, is a member of the G protein coupled receptor family that binds CXCL12 (SDF1). CXCR4 and CXCL12 play an important role in immune and inflammatory responses through the regulation of cell migration and growth. CXCR4 plays a crucial role in the pathogenesis of several autoimmune diseases such as atherosclerosis, rheumatoid arthritis, and wound healing. In addition, CXCR4 is the cofactor for fusion and entry of the T cell-tropic form of HIV-1.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse CXCR4-transfected cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: in vivo blocking1

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Costa MJ, et al. 2018. PLoS One. 13:e0194688 (Block) PubMed
Product Citations
  1. Lin YH 2023. Immunity. 56(1):207-223.e8. PubMed
  2. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
RRID
AB_2800682 (BioLegend Cat. No. 146520)

Antigen Details

Structure
G-protein-coupled seven transmembrane receptor, 39.7 kD
Distribution

T lymphocytes, monocytes, macrophages, tissue-committed stem/progenitor cells (TCSCs), mast cells, vascular smooth muscle cells (VSMCs)

Function
Development of cardiovascular and central nervous system, hematopoiesis, and colonization of BM by fetal liver-derived hematopoietic stem cells (HSCs) during embryogenesis, homing and egress of CD34+ CXCR4+ progenitor cells from bone marrow, and their migration into peripheral tissues. Critical role in homing of cancer cells to specific metastatic sites. Possible role in the ubiquitin proteosome system.
Interaction
Robo -1
Ligand/Receptor
CXCL12 (SDF-1)
Cell Type
Macrophages, Mast cells, Mesenchymal Stem Cells, Monocytes, Neural Stem Cells, T cells
Biology Area
Angiogenesis, Cell Biology, Cell Motility/Cytoskeleton/Structure, Immunology, Neuroscience, Neuroscience Cell Markers, Signal Transduction, Stem Cells, Ubiquitin/Protein Degradation
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References

1. Kucia M, et al. 2005. Stem Cells 23:879.
2. Muller A, et al. 2001. Nature 410:50.
3. Saini V, et al. 2010. J. Biol. Chem. 285:15566.
4. Prasad A, et al. 2007. J. Leuko. Biol. 82:465. 
5. De Klerck B, et al. 2005. Arthritis Res. Ther. 7:R1208.
6. Rueda P, et al. 2008. PLoS One 3:e2543. 
7. Feng Y, et al. 1996. Science 272:872.

Gene ID
12767 View all products for this Gene ID
UniProt
View information about CD184 on UniProt.org
Go To Top Version: 1    Revision Date: 01/31/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account