TotalSeq™-A0449 anti-mouse CD326 (Ep-CAM) Antibody

Pricing & Availability
Clone
G8.8 (See other available formats)
Regulatory Status
RUO
Other Names
CD326, EGP40, MIC18, TROP1, KSA
Isotype
Rat IgG2a, κ
Barcode Sequence
ACCCGCGTTAGTATG
Cat # Size Price Quantity Check Availability
118237 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

EpCAM (CD326) mediates calcium-independent homophilic cell to cell adhesion. It may also function as a growth factor receptor. It is thought to be involved in maintaining cells in position during proliferation. Expression of EpCAM seems to correlate inversely with the level of E-cadherin (CD324). EpCAM is considered important in tumor biology.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
TE-71 thymic epithelial cell line
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications for clone G8.8 (for the relevant formats) include: immunohistochemistry of frozen sections: acetone fixed1, with or without OCT embedding2,4, and spatial biology (IBEX)13,14.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Farr A, et al. 1991. J. Histochem. Cytochem. 39:645. (FC, IHC)
  2. Dooley J, et al. 2005. J. Immunol. 175:4331. (FC, IHC)
  3. Hinterberger M, et. al. 2010. Nat. Immunol. 11:512. (FC) PubMed
  4. Gracz AD, et al. 2010. Am J. Physiol Gastrointest Liver Physiol. 298:590. (IHC) PubMed
  5. Nudel I, et al. 2011. J. Immunol. 186:891. PubMed
  6. Morimoto H, et al. 2012. Biol Reprod. 86:148. PubMed
  7. Ishii K, et al. 2012. Development. 139:1734. PubMed
  8. Takehashi M, et al. 2012. Biol Reprod. 86:178. PubMed
  9. Murakami R, et al. 2013. PLoS One. 8:73270. PubMed
  10. Taguchi K, et al. 2014. Mol Cell Biol. 34:900. PubMed
  11. Hirokawa Y, et al. 2014. Am J Physiol Gastrointerest Liver Physiol. 306:547. PubMed
  12. Ding X, et al. 2015. Cancer Res. 75:330. PubMed
  13. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  14. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2800586 (BioLegend Cat. No. 118237)

Antigen Details

Structure
40 kD single-pass type 1 glycoprotein. 293 amino acids, with a 21 aa signal peptide, a 246 aa extracellular domain, a 21 aa transmembrane domain, and a 26 aa cytoplasmic domain. The extracellular domain contains two epidermal growth factor-like repeats.
Distribution

Expressed on majority of epithelial cell membranes with the exception of adult squamous cells of the skin and a few specific epithelial cell types.

Function
Mediates calcium-independent homophilic cell-cell adhesion.
Interaction
CD326 displays hemophilic binding.
Ligand/Receptor
CD305 (LAIR-1), CD306 (LAIR-2), and Ep-CAM.
Cell Type
Embryonic Stem Cells, Epithelial cells
Biology Area
Immunology, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Borkowski TA, et al. 1996. Eur. J. Immunol. 26:110.
2. Bergsagel PL, et al. 1992. J. Immunol. 148:590.

Gene ID
17075 View all products for this Gene ID
UniProt
View information about CD326 on UniProt.org

Other Formats

View All CD326 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-mouse CD326 (Ep-CAM) G8.8 FC
Purified anti-mouse CD326 (Ep-CAM) G8.8 FC,IHC-F,ICC
Biotin anti-mouse CD326 (Ep-CAM) G8.8 FC
PE anti-mouse CD326 (Ep-CAM) G8.8 FC
FITC anti-mouse CD326 (Ep-CAM) G8.8 FC
Alexa Fluor® 488 anti-mouse CD326 (Ep-CAM) G8.8 FC,IHC-F,3D IHC
Alexa Fluor® 647 anti-mouse CD326 (Ep-CAM) G8.8 FC,IHC-F,3D IHC,SB
PE/Cyanine7 anti-mouse CD326 (Ep-CAM) G8.8 FC
APC/Cyanine7 anti-mouse CD326 (Ep-CAM) G8.8 FC
PerCP/Cyanine5.5 anti-mouse CD326 (Ep-CAM) G8.8 FC
Alexa Fluor® 594 anti-mouse CD326 (Ep-CAM) G8.8 ICC,IHC-F,3D IHC
Brilliant Violet 421™ anti-mouse CD326 (Ep-CAM) G8.8 FC
Brilliant Violet 605™ anti-mouse CD326 (Ep-CAM) G8.8 FC
Purified anti-mouse CD326 (Ep-CAM) (Maxpar® Ready) G8.8 FC,CyTOF®
APC/Fire™ 750 anti-mouse CD326 (Ep-CAM) G8.8 FC
Brilliant Violet 711™ anti-mouse CD326 (Ep-CAM) G8.8 FC
Brilliant Violet 510™ anti-mouse CD326 (Ep-CAM) G8.8 FC
PE/Dazzle™ 594 anti-mouse CD326 (Ep-CAM) G8.8 FC
TotalSeq™-A0449 anti-mouse CD326 (Ep-CAM) G8.8 PG
Alexa Fluor® 700 anti-mouse CD326 (Ep-CAM) G8.8 FC
TotalSeq™-C0449 anti-mouse CD326 (Ep-CAM) G8.8 PG
Brilliant Violet 785™ anti-mouse CD326 (Ep-CAM) G8.8 FC
TotalSeq™-B0449 anti-mouse CD326 (Ep-CAM) G8.8 PG
Brilliant Violet 650™ anti-mouse CD326 (Ep-CAM) G8.8 FC
PE/Cyanine5 anti-mouse CD326 (Ep-CAM) G8.8 FC
Spark Red™ 718 anti-mouse CD326 (Ep-CAM) (Flexi-Fluor™) G8.8 FC
Spark Blue™ 574 anti-mouse CD326 (Ep-CAM) (Flexi-Fluor™) G8.8 FC
Spark Blue™ 550 anti-mouse CD326 (Ep-CAM) (Flexi-Fluor™) G8.8 FC
Go To Top Version: 1    Revision Date: 01/16/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account