- Clone
- 11-26c.2a (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Immunoglobulin D
- Isotype
- Rat IgG2a, κ
- Barcode Sequence
- TCATATCCGTTGTCC
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
405745 | 10 µg | $369.00 |
Surface IgD is an important B cell differentiation marker.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The 11-26c.2a antibody reacts with immunoglobulin D in all tested mouse haplotypes. The antibody binds membrane IgD expressed on most B cells. The 11-26c.2a antibody neither induces proliferation of splenic B cells nor induces B cell activation. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections2,3, and spatial biology (IBEX)10,11.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Nitschke L, et al. 1993. P. Natl. Acad. Sci. USA 90:1887. (FC)
- Weih D, et al. 2001. J. Immunol. 167:1909. (IHC)
- Koni PA, et al. 2001. J. Exp. Med. 193:741. (IHC)
- Ahuja A, et al. 2007. J. Immunol. 179:3351. (FC) PubMed
- Haynes NM, et al. 2007. J. Immunol. 179:5099. (FC)
- Good-Jacobson KL, et al. 2010. Nat. Immunol. 11:535. (FC) PubMed
- Tomayko MM, et al. 2010. J. Immunol. 185:7146. PubMed
- Park SY, et al. 2013. J. Immunol. 190:1094. PubMed
- Rouaud P, et al. 2014. J Exp Med. 211:975. PubMed
- Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2783321 (BioLegend Cat. No. 405745)
Antigen Details
- Structure
- Ig family
- Distribution
-
B cells
- Function
- B cell differentiation
- Cell Type
- B cells
- Biology Area
- Immunology
- Gene ID
- 380797 View all products for this Gene ID
- UniProt
- View information about IgD on UniProt.org
Other Formats
View All IgD Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-mouse IgD
-
PE anti-mouse IgD
-
Purified anti-mouse IgD
-
PerCP anti-mouse IgD
-
Biotin anti-mouse IgD
-
Brilliant Violet 711™ anti-mouse IgD
-
Alexa Fluor® 700 anti-mouse IgD
-
Alexa Fluor® 647 anti-mouse IgD
-
PerCP/Cyanine5.5 anti-mouse IgD
-
Pacific Blue™ anti-mouse IgD
-
APC anti-mouse IgD
-
APC/Cyanine7 anti-mouse IgD
-
Alexa Fluor® 488 anti-mouse IgD
-
PE/Cyanine7 anti-mouse IgD
-
Brilliant Violet 650™ anti-mouse IgD
-
Brilliant Violet 510™ anti-mouse IgD
-
Brilliant Violet 421™ anti-mouse IgD
-
Brilliant Violet 605™ anti-mouse IgD
-
Purified anti-mouse IgD (Maxpar® Ready)
-
Alexa Fluor® 594 anti-mouse IgD
-
PE/Dazzle™ 594 anti-mouse IgD
-
APC/Fire™ 750 anti-mouse IgD
-
TotalSeq™-A0571 anti-mouse IgD
-
TotalSeq™-C0571 anti-mouse IgD
-
Spark NIR™ 685 anti-mouse IgD
-
TotalSeq™-B0571 anti-mouse IgD Antibody
-
Spark Violet™ 423 anti-mouse IgD
-
PE/Cyanine5 anti-mouse IgD
-
Brilliant Violet 785™ anti-mouse IgD
-
Spark PLUS UV395™ anti-mouse IgD