- Clone
- 7E.17G9 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Inducible COStimulatory molecule, H4
- Isotype
- Rat IgG2b, κ
- Barcode Sequence
- ACTGCCATATCCCTA
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
117409 | 10 µg | $369.00 |
The 7E.17G9 antibody reacts with the 47-57 kD ICOS protein, also known as inducible costimulatory molecule, and H4. This protein is homologous to the CD28/CTLA-4 proteins. ICOS is expressed on activated T cells and a subset of thymocytes and can costimulate T cells and induce proliferation. In addition ICOS has been shown to be involved in humoral immune responses (B cell germinal center formation). The ICOS ligand, B7h/B7RP-1 and B7-H2 is constitutively expressed in B cell areas of secondary lymphoid organs and can be induced in other tissues by LPS. ICOS stimulation has been shown to potentiate TCR-mediated IL-4 and IL-10 production and has been proposed to play a role in Th2 cell development. ICOS stimulation has been shown to be involved in airway tolerance and the downregulation of pulmonary inflammation.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Mouse ICOS cDNA and ICOS hexahistidine fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: blocking of ligand binding. The LEAF™ format is suggested for blocking studies.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Akbari O, et al. 2002. Nat. Med. 8:1024.
- Harada H, et al. 2003. J. Clin. Invest. 112:234.
- McAdam AJ, et al. 2000. J. Immunol. 165:5035. (FC Block)
- Tan SL, et al. 2006. J. Immunol. 176:2872. PubMed
- Product Citations
-
- RRID
-
AB_2800585 (BioLegend Cat. No. 117409)
Antigen Details
- Structure
- CD28/CTLA-4, 47-57kD
- Distribution
-
Activated T cells, subset of thymocytes
- Function
- Costimulates T cell activation, proliferation, humoral immune response
- Ligand/Receptor
- B7h/B7RP-1/GL-50
- Cell Type
- T cells, Thymocytes
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Rudd CE, et al. 2003. Nat. Rev. Immunol. 3:544.
2. McAdam AJ, et al. 2000. J. Immunol. 165:5035.
3. Mak TW, et al. 2003. Nat. Immunol. 4:765 - Gene ID
- 54167 View all products for this Gene ID
- UniProt
- View information about CD278 on UniProt.org
Other Formats
View All CD278 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Biotin anti-mouse CD278 (ICOS) | 7E.17G9 | FC |
PE anti-mouse CD278 (ICOS) | 7E.17G9 | FC |
TotalSeq™-A0847 anti-mouse CD278 (ICOS) | 7E.17G9 | PG |
TotalSeq™-C0847 anti-mouse CD278 (ICOS) | 7E.17G9 | PG |
Ultra-LEAF™ Purified anti-mouse CD278 (ICOS) | 7E.17G9 | FC,Block |
PE/Cyanine7 anti-mouse CD278 (ICOS) | 7E.17G9 | FC |
PerCP/Cyanine5.5 anti-mouse CD278 (ICOS) | 7E.17G9 | FC |
APC anti-mouse CD278 (ICOS) | 7E.17G9 | FC |
TotalSeq™-B0847 anti-mouse CD278 (ICOS) | 7E.17G9 | PG |
Spark Red™ 718 anti-mouse CD278 (ICOS) | 7E.17G9 | FC |
Brilliant Violet 421™ anti-mouse CD278 (ICOS) | 7E.17G9 | FC |
Brilliant Violet 711™ anti-mouse CD278 (ICOS) | 7E.17G9 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Biotin anti-mouse CD278 (ICOS)
-
PE anti-mouse CD278 (ICOS)
-
TotalSeq™-A0847 anti-mouse CD278 (ICOS)
-
TotalSeq™-C0847 anti-mouse CD278 (ICOS)
-
Ultra-LEAF™ Purified anti-mouse CD278 (ICOS)
-
PE/Cyanine7 anti-mouse CD278 (ICOS)
-
PerCP/Cyanine5.5 anti-mouse CD278 (ICOS)
-
APC anti-mouse CD278 (ICOS)
-
TotalSeq™-B0847 anti-mouse CD278 (ICOS)
-
Spark Red™ 718 anti-mouse CD278 (ICOS)
-
Brilliant Violet 421™ anti-mouse CD278 (ICOS)
-
Brilliant Violet 711™ anti-mouse CD278 (ICOS)