TotalSeq™-A0847 anti-mouse CD278 (ICOS) Antibody

Pricing & Availability
Clone
7E.17G9 (See other available formats)
Regulatory Status
RUO
Other Names
Inducible COStimulatory molecule, H4
Isotype
Rat IgG2b, κ
Barcode Sequence
ACTGCCATATCCCTA
Cat # Size Price Quantity Check Availability
117409 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The 7E.17G9 antibody reacts with the 47-57 kD ICOS protein, also known as inducible costimulatory molecule, and H4. This protein is homologous to the CD28/CTLA-4 proteins. ICOS is expressed on activated T cells and a subset of thymocytes and can costimulate T cells and induce proliferation. In addition ICOS has been shown to be involved in humoral immune responses (B cell germinal center formation). The ICOS ligand, B7h/B7RP-1 and B7-H2 is constitutively expressed in B cell areas of secondary lymphoid organs and can be induced in other tissues by LPS. ICOS stimulation has been shown to potentiate TCR-mediated IL-4 and IL-10 production and has been proposed to play a role in Th2 cell development. ICOS stimulation has been shown to be involved in airway tolerance and the downregulation of pulmonary inflammation.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse ICOS cDNA and ICOS hexahistidine fusion protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: blocking of ligand binding. The LEAF™ format is suggested for blocking studies.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Akbari O, et al. 2002. Nat. Med. 8:1024.
  2. Harada H, et al. 2003. J. Clin. Invest. 112:234.
  3. McAdam AJ, et al. 2000. J. Immunol. 165:5035. (FC Block)
  4. Tan SL, et al. 2006. J. Immunol. 176:2872. PubMed
Product Citations
  1. Lin YH 2023. Immunity. 56(1):207-223.e8. PubMed
RRID
AB_2800585 (BioLegend Cat. No. 117409)

Antigen Details

Structure
CD28/CTLA-4, 47-57kD
Distribution

Activated T cells, subset of thymocytes

Function
Costimulates T cell activation, proliferation, humoral immune response
Ligand/Receptor
B7h/B7RP-1/GL-50
Cell Type
T cells, Thymocytes
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Rudd CE, et al. 2003. Nat. Rev. Immunol. 3:544.
2. McAdam AJ, et al. 2000. J. Immunol. 165:5035.
3. Mak TW, et al. 2003. Nat. Immunol. 4:765

Gene ID
54167 View all products for this Gene ID
UniProt
View information about CD278 on UniProt.org
Go To Top Version: 1    Revision Date: 03/14/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account