TotalSeq™-A0931 anti-human CD131 Antibody

Product Details

Verified Reactivity

Human

Reported Reactivity

African Green, Baboon, Cynomolgus, Rhesus

Antibody Type

Monoclonal

Host Species

Mouse

Immunogen

Human IL-3R β chain transfected COS cells

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Application Notes

Additional reported applications (for the relevant formats) include: Western blotting^1,2 and immunoprecipitation². The 1C1 antibody does not block binding of IL-3 and is a non-neutralizing antibody.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)

1. Stomski F, et al. 1998. J. Biol. Chem. 273:1192. (WB)
2. Stomski F, et al. 1999. Blood 94:1933. (IP WB)
3. Mark A, et al. 2000. Mol. Cell 6:99.

RRID

AB_2832602 (BioLegend Cat. No. 306105)

Antigen Details

Structure

Ig superfamily, type I transmembrane glycoprotein, associates with the α subunit of IL-3, IL-5, GM-CSF receptors, 95-120 kD

Distribution

Low levels on monocytes, granulocytes, eosinophils, basophils, hematopoietic progenitors, endothelial cells

Function

Signal transducing molecule of IL-3, IL-5, GM-CSF receptors

Ligand/Receptor

IL-3, IL-5, GM-CSF

Cell Type

Basophils, Endothelial cells, Eosinophils, Granulocytes, Hematopoietic stem and progenitors, Monocytes

Biology Area

Immunology

Molecular Family

CD Molecules, Cytokine/Chemokine Receptors

Antigen References

1. Sun Q, et al. 1999. Blood 94:1943.
2. Woodcock J, et al. 1997. Blood 90:3005.
3. Lopez A, et al. 1991. J. Biol. Chem. 266:24741.

Gene ID

1439 View all products for this Gene ID

UniProt

View information about CD131 on UniProt.org

Related Protocols

• TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v3 3.1 Protocol

Other Formats