- Clone
- RMG1-1 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Immunoglobulin G1
- Isotype
- Rat IgG
- Barcode Sequence
- AGTACCTGCATGTCA
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
406635 | 10 µg | $369.00 |
The RMG1-1 monoclonal antibody reacts with immunoglobulin G1 (IgG1) in all tested mouse haplotype (Igh-a and b). It does not react with other isotypes. The RMG1-1 monoclonal antibody may be used as a primary or secondary reagent for ELISA or immunofluorescent analysis.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Mouse Ig cocktail
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2904427 (BioLegend Cat. No. 406635)
Antigen Details
- Ligand/Receptor
- javascript:void(0);
- Gene ID
- 16017 View all products for this Gene ID
- UniProt
- View information about IgG1 on UniProt.org
Other Formats
View All IgG1 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PerCP/Cyanine5.5 anti-mouse IgG1 | RMG1-1 | FC |
Purified anti-mouse IgG1 | RMG1-1 | ELISA,FC |
Biotin anti-mouse IgG1 | RMG1-1 | ELISA,IHC-F |
FITC anti-mouse IgG1 | RMG1-1 | FC |
PE anti-mouse IgG1 | RMG1-1 | FC |
APC anti-mouse IgG1 | RMG1-1 | FC |
PE/Cyanine7 anti-mouse IgG1 | RMG1-1 | FC |
Brilliant Violet 421™ anti-mouse IgG1 | RMG1-1 | FC |
Alexa Fluor® 647 anti-mouse IgG1 | RMG1-1 | FC,IHC-F,IHC-P |
APC/Cyanine7 anti-mouse IgG1 | RMG1-1 | FC |
Brilliant Violet 510™ anti-mouse IgG1 | RMG1-1 | FC |
Alexa Fluor® 488 anti-mouse IgG1 | RMG1-1 | FC |
APC/Fire™ 750 anti-mouse IgG1 | RMG1-1 | FC |
PE/Dazzle™ 594 anti-mouse IgG1 | RMG1-1 | FC |
Brilliant Violet 650™ anti-mouse IgG1 | RMG1-1 | FC |
Alexa Fluor® 700 anti-mouse IgG1 | RMG1-1 | FC |
Alexa Fluor® 594 anti-mouse IgG1 | RMG1-1 | IHC-P |
TotalSeq™-A1167 anti-mouse IgG1 | RMG1-1 | PG |
TotalSeq™-C1167 anti-mouse IgG1 | RMG1-1 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PerCP/Cyanine5.5 anti-mouse IgG1
-
Purified anti-mouse IgG1
-
Biotin anti-mouse IgG1
-
FITC anti-mouse IgG1
-
PE anti-mouse IgG1
-
APC anti-mouse IgG1
-
PE/Cyanine7 anti-mouse IgG1
-
Brilliant Violet 421™ anti-mouse IgG1
-
Alexa Fluor® 647 anti-mouse IgG1
-
APC/Cyanine7 anti-mouse IgG1
-
Brilliant Violet 510™ anti-mouse IgG1
-
Alexa Fluor® 488 anti-mouse IgG1
-
APC/Fire™ 750 anti-mouse IgG1
-
PE/Dazzle™ 594 anti-mouse IgG1
-
Brilliant Violet 650™ anti-mouse IgG1
-
Alexa Fluor® 700 anti-mouse IgG1
-
Alexa Fluor® 594 anti-mouse IgG1
-
TotalSeq™-A1167 anti-mouse IgG1
-
TotalSeq™-C1167 anti-mouse IgG1