- Clone
- SA231A2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CLEC15A, MAFA-L, MAFA-2F1, MAFA-LIKE, 2F1
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- CTTATTTCCTGCCCT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Killer cell lectin-like receptor subfamily G member 1 (KLRG1) is a 30 kD, type II membrane glycoprotein with one C-type lectin domain and one immunoreceptor tyrosine-based inhibititory motif (ITIM). KLRG1 is expressed by subsets of NK, effector and memory T cells. KLRG1 inhibits cell activation and proliferation, and is a marker of T cell senescence. Binding of KLRG1 to E-, N-, or R- cadherins blocks phosphorylation of Akt and increases the expression of cell cycle inhibitors.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human KLRG1-transfected cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2894623 (BioLegend Cat. No. 367735)
Antigen Details
- Structure
- Type II membrane glycoprotein, one C-type lectin domain, one ITIM, 30 kD.
- Distribution
-
Subsets of NK, effector and memory T cells.
- Function
- Inhibits cell activation and proliferation, marker of T cell senescence.
- Interaction
- AKT
- Ligand/Receptor
- E-, N-, and R- cadherins
- Cell Type
- NK cells, T cells
- Biology Area
- Immunology, Innate Immunity
- Antigen References
-
1. Shi L, et al. 2014. J. Immunol. 192:649.
- Gene ID
- 10219 View all products for this Gene ID
- UniProt
- View information about KLRG1 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All KLRG1 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 Br... -
Alexa Fluor® 647 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD16 Br... -
Brilliant Violet 421™ anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 PE... -
PerCP/Cyanine5.5 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 AP... -
PE/Dazzle™ 594 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 AP... -
APC anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 PE... -
PE anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 AP... -
FITC anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 AP... -
APC/Fire™ 750 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 PE... -
PE/Cyanine7 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 FI... -
TotalSeq™-A0153 anti-human KLRG1 (MAFA)
-
APC/Cyanine7 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 FI... -
KIRAVIA Blue 520™ anti-human KLRG1 (MAFA) Antibody
Human peripheral blood lymphocytes were stained with CD56 PE... -
TotalSeq™-B0153 anti-human KLRG1 (MAFA) Antibody
-
Alexa Fluor® 700 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with CD56 PE... -
APC/Fire™ 810 anti-human KLRG1 (MAFA) Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-D0153 anti-human KLRG1 (MAFA)
-
PE/Fire™ 810 anti-human KLRG1 (MAFA) Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-C0153 anti-human KLRG1 (MAFA)
-
Spark NIR™ 685 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 640 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with anti-hu... -
Brilliant Violet 711™ anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 780 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 806 anti-human KLRG1 (MAFA)
Human lysed whole blood cells were stained with anti-human C... -
PE/Fire™ 700 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 744 anti-human KLRG1 (MAFA)
Human peripheral blood lymphocytes were stained with anti-hu...
Follow Us