- Clone
- HI264 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VII 70312
- Other Names
- PAS-2, Sialoglycoprotein alpha, MN sialoglycoprotein, Glycophorin A, MNS blood group, GYPA
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- AGAGTATGTATGGGA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD235a (Glycophorin A) is member of the glycophorin A family. It is a type I sialoglycoprotein with a molecular weight of 10 kD, present in the cell membrane as a homodimer. Glycophorin A is expressed by erythroid precursors and erythrocytes. It carries the antigen determinants for the MNS blood groups and has been proposed to be an inhibitor of hemagglutination and hemolysis. Glycophorin A binds siglec 5, the erythrocyte binding antigen (EBA-175) of P. falciparum and some viruses, including influenza virus and hepatitis A virus.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Mason D, et al. Eds. 2002. Leucocyte Typing VII:White Cell Differentiation Antigens. Oxford University Press. (FC)
- RRID
-
AB_2904370 (BioLegend Cat. No. 349125)
Antigen Details
- Structure
- Member of the glycophorin A family; type I protein with a molecular weight of 10 kD; present in the membrane as homodimer
- Distribution
-
Erythrocytes and erythroid precursors
- Function
- Possible inhibitor of hemagglutination and hemolysis; carries the antigen determinants for the MNS blood groups
- Ligand/Receptor
- Siglec 5, erythrocyte binding antigen (EBA-175) of P. falciparum, receptor for the influenza virus, hepatitis A virus
- Cell Type
- Erythrocytes
- Biology Area
- Cell Adhesion, Cell Biology, Immunology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Reid ME. 2009. Immunohematology 25:95.
2. Palacajornsuk P. 2006. Immunohematology 22:171.
3. Pasvol G. 2003. Trends Parasitol. 19:430.
4. Takakuwa Y. 2001. Curr. Opin. Hematol. 8:80. - Gene ID
- 2993 View all products for this Gene ID
- UniProt
- View information about CD235a on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD235a Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Pacific Blue™ anti-human CD235a (Glycophorin A)
Human red blood cells stained with anti-human CD235a (clone ... -
PE anti-human CD235a (Glycophorin A)
Human red blood cells stained with HI264 PE -
Purified anti-human CD235a (Glycophorin A)
Human red blood cells stained with purified HI264 conjugated... -
FITC anti-human CD235a (Glycophorin A)
Human red blood cells stained with HI264 FITC -
PerCP/Cyanine5.5 anti-human CD235a (Glycophorin A)
Human red blood cells were stained with anti-human CD235a (c... -
PE/Cyanine7 anti-human CD235a (Glycophorin A)
Human red blood cells were stained with anti-human CD235a (c... -
APC anti-human CD235a (Glycophorin A)
Human red blood cells were stained with anti-human CD235a (c... -
APC/Cyanine7 anti-human CD235a (Glycophorin A)
Human red blood cells were stained with anti-human CD235a (c... -
TotalSeq™-A0574 anti-human CD235a (Glycophorin A)
-
PE/Dazzle™ 594 anti-human CD235a (Glycophorin A)
Human red blood cells were stained with CD235a (Glycophorin ... -
TotalSeq™-C0574 anti-human CD235a (Glycophorin A)
-
Alexa Fluor® 700 anti-human CD235a (Glycophorin A)
Human red blood cells were stained with anti-human CD235a (c... -
TotalSeq™-D0574 anti-human CD235a (Glycophorin A)
-
Alexa Fluor® 647 anti-human CD235a (Glycophorin A)
Human red blood cells were stained with anti-human CD235a (G... -
Biotin anti-human CD235a (Glycophorin A)
Human red blood cells were stained with biotinylated anti-hu... -
Brilliant Violet 421™ anti-human CD235a (Glycophorin A)
Human red blood cells were stained with anti-human CD235a (G... -
Spark UV™ 387 anti-human CD235a (Glycophorin A)
Human red blood cells stained with anti-human CD235a (clone ... -
TotalSeq™-B0574 anti-human CD235a (Glycophorin A)
Follow Us