IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0032 anti-human CD154 Antibody

Pricing & Availability
Clone
24-31 (See other available formats)
Regulatory Status
RUO
Other Names
CD40L, gp39, TRAP, T-BAM, TNFSF5
Isotype
Mouse IgG1, κ
Barcode Sequence
GCTAGATAGATGCAA
Ave. Rating
Submit a Review
Cat # Size Price Quantity Check Availability Save
310853 10 µg $369
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD154 (CD40 ligand) is also known as CD40L, gp39, TRAP and T-BAM. CD40 ligand is a 32-39 kD type II transmembrane glycoprotein. It is a member of the TNF superfamily and is expressed on activated T cells. It has been reported to be important for B cell costimulation following binding of its receptor, CD40. Additionally, binding of CD40L to CD40 on B cells promotes the secretion of immunoglobulin and Ig isotype switching. CD40L is also involved in the regulation of cytokine production by T cells.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunofluorescence microscopy1,3 and blocking of T cell-dependent B cell differentiation1,2,4,5. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 310812). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 310828) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Brams P, et al. 2001. Int. Immunopharmacol. 1:277. (Block, IF)
  2. Rushworth SA, et al. 2002. Transplantation 73:635. (Block)
  3. Berner B, et al. 2000. Ann. Rheum. Dis. 59:190. (IF)
  4. Nordström T, et al. 2006. J. Leukocyte Biol. 79:319. (Block)
  5. Zhang AL, et al.2007. Blood doi:10.1182/blood-2007-02-076364. (Block) PubMed
  6. Kuchen S, et al. 2007. J. Immunol. 179:5886.
  7. Matus-Nicodermos R, et al. 2011. J. Immunol. 186:2164. PubMed
  8. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID
AB_2894564 (BioLegend Cat. No. 310853)

Antigen Details

Structure
TNF superfamily, type II transmembrane glycoprotein, cleaved as soluble CD40L, 32-39 kD
Distribution

Activated T cells

Function
B cell costimulation
Ligand/Receptor
CD40
Cell Type
T cells, Tregs
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Najafian N, et al. 2003. Expert Opin. Biol. Ther. 3:227.
2. Racke M, et al. 2002. Expert Opin. Ther. Targets. 6:275.
3. Ford G, et al. 1999. J. Immunol. 162:4037.

Gene ID
959 View all products for this Gene ID
UniProt
View information about CD154 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD154 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD154 24-31 FC,IHC-F
FITC anti-human CD154 24-31 FC,IHC-F
PE anti-human CD154 24-31 FC
PE/Cyanine5 anti-human CD154 24-31 FC
APC anti-human CD154 24-31 FC
Biotin anti-human CD154 24-31 FC,IHC-F
Alexa Fluor® 488 anti-human CD154 24-31 FC,IHC-F
Alexa Fluor® 647 anti-human CD154 24-31 FC,IHC-F
Pacific Blue™ anti-human CD154 24-31 FC
Brilliant Violet 785™ anti-human CD154 24-31 FC
APC/Cyanine7 anti-human CD154 24-31 FC
Brilliant Violet 421™ anti-human CD154 24-31 FC,IHC-F
Brilliant Violet 605™ anti-human CD154 24-31 FC
Ultra-LEAF™ Purified anti-human CD154 24-31 FC,Block,IHC-F
Brilliant Violet 510™ anti-human CD154 24-31 FC,IHC-F
PE/Cyanine7 anti-human CD154 24-31 FC
PerCP/Cyanine5.5 anti-human CD154 24-31 FC
Brilliant Violet 711™ anti-human CD154 24-31 FC
Purified anti-human CD154 (Maxpar® Ready) 24-31 FC,CyTOF®
PE/Dazzle™ 594 anti-human CD154 24-31 FC
TotalSeq™-A0032 anti-human CD154 24-31 PG
Alexa Fluor® 700 anti-human CD154 24-31 FC
APC/Fire™ 750 anti-human CD154 24-31 FC
TotalSeq™-C0032 anti-human CD154 24-31 PG
TotalSeq™-B0032 anti-human CD154 24-31 PG
TotalSeq™-D0032 anti-human CD154 24-31 PG
PE/Fire™ 640 anti-human CD154 24-31 FC
PE/Fire™ 810 anti-human CD154 24-31 FC
PerCP/Fire™ 780 anti-human CD154 24-31 FC
PE/Fire™ 700 anti-human CD154 24-31 FC
Spark Red™ 718 anti-human CD154 (Flexi-Fluor™) 24-31 FC
Brilliant Violet 650™ anti-human CD154 24-31 FC
PerCP/Fire™ 806 anti-human CD154 24-31 FC
Spark Blue™ 574 anti-human CD154 (Flexi-Fluor™) 24-31 FC
Spark Blue™ 550 anti-human CD154 (Flexi-Fluor™) 24-31 FC
PE/Cyanine7 anti-human CD154 24-31 FC
Go To Top Version: 1    Revision Date: 08/04/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.


Login/Register
Remember me
Forgot your password? Reset Password
Request an Account
My Cart (0 items)