TotalSeq™-A0014 anti-mouse/human CD11b Antibody

Pricing & Availability
Clone
M1/70 (See other available formats)
Regulatory Status
RUO
Other Names
αM integrin, Mac-1, Mo1, CR3, Ly-40, C3biR, ITGAM
Isotype
Rat IgG2b, κ
Barcode Sequence
TGAAGGCTCATTTGT
Compare all formats
Cat # Size Price Quantity Check Availability
101265 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD11b is a 170 kD glycoprotein also known as αM integrin, Mac-1 α subunit, Mol, CR3, and Ly-40. CD11b is a member of the integrin family, primarily expressed on granulocytes, monocytes/macrophages, dendritic cells, NK cells, and subsets of T and B cells. CD11b non-covalently associates with CD18 (β2 integrin) to form Mac-1. Mac-1 plays an important role in cell-cell interaction by binding its ligands ICAM-1 (CD54), ICAM-2 (CD102), ICAM-4 (CD242), iC3b, and fibrinogen.

Technical data sheet

Product Details

Verified Reactivity
Mouse, Human, Cynomolgus, Rhesus
Reported Reactivity
Chimpanzee, Baboon, Rabbit
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
C57BL/10 splenocytes
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone M1/70 has been verified for immunocytochemistry (ICC) and frozen immunohistochemistry (IHC-F).

Additional reported applications (for relevant formats of this clone) include: immunoprecipitation1,4, in vitro blocking3,9,12, depletion2,8, immunofluorescence microscopy6,7,10, immunohistochemistry of acetone-fixed frozen sections5,11-13, and spatial biology (IBEX)35,36. For in vivo studies or highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) (Cat. No. 101248).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Springer T, et al. 1978. Eur. J. Immunol. 8:539. (IP)
  2. Ault K and Springer T. 1981. J. Immunol. 126:359. (Deplete)
  3. Springer TA, et al. 1982. Immunol. Rev. 68:171. (Block)
  4. Ho MK and Springer TA. 1983. J. Biol. Chem. 258:2766. (IP)
  5. Flotte TJ, et al. 1983. Am. J. Pathol. 111:112. (IHC)
  6. Noel GJ, et al. 1990. J. Clin. Invest. 85:208. (IF)
  7. Allen LA and Aderem A. 1996. J. Exp. Med. 184:627 (IF)
  8. D'Amico A and Wu L. 2003. J. Exp. Med. 198:293. (Deplete)
  9. Brickson SJ, et al. 2003. Appl Physiol. 95:969. (Block)
  10. Clatworthy MR and Smith KG. 2004. J. Exp. Med. 199:717. (IF)
  11. Hata H, et al. 2004. J. Clin. Invest. 114:582. (IHC)
  12. Zhang Y, et al. 2002. J. Immunol. 168:3088. (IHC)
  13. Iwasaki A and Kelsall BL. 2001. J. Immunol. 166:4884 (IHC, FC)
  14. Tailleux L. 2003. J. Exp. Med. 197:121. (Block, FC)
  15. Olver S, et al. 2006. Cancer Research 66:571. (FC)
  16. Tan SL, et al. 2006. J. Immunol. 176:2872. (FC) PubMed
  17. Ponomarev ED, et al. 2006. J. Immunol. 176:1402. (FC)
  18. Dzhagalov I, et al. 2007. Blood 109:1620. (FC)
  19. Fazilleau N, et al. 2007. Nature Immunol. 8:753.
  20. Rasmussen JW, et al. 2006. Infect. Immun.74:6590. PubMed
  21. Napimoga MH, et al. 2008. J. Immunol. 180:609. PubMed
  22. Elqaraz-Carmon V, et al. 2008. J. Lipid. Res. 49:1894. PubMed
  23. Kim DD, et al. 2008. Blood 112:1109. PubMed
  24. Guo Y, et al. 2008. Blood 112:480. PubMed
  25. Norian LA, et al. 2009. Cancer Res. 69:3086. (FC) PubMed
  26. Baumgartner CK, et al. 2010. J. Immunol. 184:573. PubMed
  27. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  28. Whiteland J, et al. 1995. J. Histochem. Cytochem. 43:313. (IHC)
  29. Weber GF, et al. 2014. J Exp Med. 211:1243. PubMed
  30. Ashok A, et al. 2015. Toxicol Sci. 143:64. PubMed
  31. Price PJ, et al. 2015. J Immunol. 194:1164. PubMed
  32. Doni A, et al. 2015. J Exp Med. 212:905. PubMed
  33. Ferreira R, et al. 2016. J Infect Dis. 213: 669 - 673. PubMed
  34. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
  35. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  36. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
Product Citations
  1. Rødahl I, et al. 2021. STAR Protoc. 2:100842. PubMed
  2. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  3. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  4. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  5. Guilliams M, et al. 2022. Cell. 185:379. PubMed
  6. Wirka RC, et al. 2019. Nat Med. 25:1280. PubMed
  7. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
  8. Hao Y, et al. 2021. Cell. 184:3573. PubMed
  9. Pisu D, et al. 2021. J Exp Med. 218:. PubMed
RRID
AB_2734152 (BioLegend Cat. No. 101265)

Antigen Details

Structure
Integrin family, associates with integrin β2 (CD18), 170 kD
Distribution

Granulocytes, monocytes/macrophages, dendritic cells, NK cells, subsets of T and B cells

Function
Adhesion, chemotaxis
Ligand/Receptor
ICAM-1 (CD54), ICAM-2 (CD102), ICAM-4 (CD242), iC3b, fibrinogen
Cell Type
B cells, Dendritic cells, Granulocytes, Macrophages, Monocytes, Neutrophils, NK cells, T cells, Tregs
Biology Area
Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity, Neuroscience, Neuroscience Cell Markers
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Springer TA. 1994. Cell 76:301.
3. Coxon A, et al. 1996. Immunity 5:653.

Gene ID
16409 View all products for this Gene ID 3684 View all products for this Gene ID
UniProt
View information about CD11b on UniProt.org

Other Formats

View All CD11b Reagents Request Custom Conjugation
Description Clone Applications
APC anti-mouse/human CD11b M1/70 FC
Biotin anti-mouse/human CD11b M1/70 FC
FITC anti-mouse/human CD11b M1/70 FC
PE anti-mouse/human CD11b M1/70 FC,IHC
PE/Cyanine5 anti-mouse/human CD11b M1/70 FC
Purified anti-mouse/human CD11b M1/70 FC,CyTOF®,IP,IHC-F,ICC
PE/Cyanine7 anti-mouse/human CD11b M1/70 FC
Alexa Fluor® 488 anti-mouse/human CD11b M1/70 FC,IHC-F,3D IHC,SB
Alexa Fluor® 647 anti-mouse/human CD11b M1/70 FC,3D IHC,SB
Alexa Fluor® 700 anti-mouse/human CD11b M1/70 FC
Pacific Blue™ anti-mouse/human CD11b M1/70 FC
APC/Cyanine7 anti-mouse/human CD11b M1/70 FC
PerCP/Cyanine5.5 anti-mouse/human CD11b M1/70 FC
PerCP anti-mouse/human CD11b M1/70 FC
Brilliant Violet 421™ anti-mouse/human CD11b M1/70 FC
Brilliant Violet 570™ anti-mouse/human CD11b M1/70 FC
Brilliant Violet 605™ anti-mouse/human CD11b M1/70 FC
Brilliant Violet 650™ anti-mouse/human CD11b M1/70 FC
Brilliant Violet 711™ anti-mouse/human CD11b M1/70 FC
Brilliant Violet 785™ anti-mouse/human CD11b M1/70 FC
Brilliant Violet 510™ anti-mouse/human CD11b M1/70 FC,ICC
Ultra-LEAF™ Purified anti-mouse/human CD11b M1/70 FC,CyTOF®,IP,Block,Depletion,IHC-F,ICC
Purified anti-mouse/human CD11b (Maxpar® Ready) M1/70 FC,CyTOF®
Alexa Fluor® 594 anti-mouse/human CD11b M1/70 IHC-F,FC
PE/Dazzle™ 594 anti-mouse/human CD11b M1/70 FC
APC/Fire™ 750 anti-mouse/human CD11b M1/70 FC
TotalSeq™-A0014 anti-mouse/human CD11b M1/70 PG
Brilliant Violet 750™ anti-mouse/human CD11b M1/70 FC
TotalSeq™-B0014 anti-mouse/human CD11b M1/70 PG
TotalSeq™-C0014 anti-mouse/human CD11b M1/70 PG
Spark NIR™ 685 anti-mouse/human CD11b M1/70 FC
PE/Fire™ 640 anti-mouse/human CD11b M1/70 FC
Spark YG™ 593 anti-mouse/human CD11b M1/70 FC
Spark YG™ 570 anti-mouse/human CD11b M1/70 IHC-F
PE/Fire™ 810 anti-mouse/human CD11b M1/70 FC
APC/Fire™ 810 anti-mouse/human CD11b Antibody M1/70 FC
Spark Blue™ 550 anti-mouse/human CD11b M1/70 FC
Spark UV™ 387 anti-mouse/human CD11b M1/70 FC
PerCP/Fire™ 806 anti-mouse/human CD11b M1/70 FC
PerCP/Fire™ 780 anti-mouse/human CD11b M1/70 FC
Spark Blue™ 574 anti-mouse/human CD11b (Flexi-Fluor™) M1/70 FC
KIRAVIA Blue 520™ anti-mouse/human CD11b M1/70 FC
PE/Fire™ 744 anti-mouse/human CD11b M1/70 FC
Spark PLUS UV395™ anti-mouse/human CD11b M1/70 FC
Spark Red™ 718 anti-mouse/human CD11b (Flexi-Fluor™) M1/70 FC
Go To Top Version: 1    Revision Date: 05/29/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account