TotalSeq™-A0015 anti-mouse Ly-6G Antibody

Pricing & Availability
Clone
1A8 (See other available formats)
Regulatory Status
RUO
Other Names
Lymphocyte antigen 6 complex, locus G
Isotype
Rat IgG2a, κ
Barcode Sequence
ACATTGACGCAACTA
Cat # Size Price Quantity Check Availability
127655 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Lymphocyte antigen 6 complex, locus G (Ly-6G), a 21-25 kD GPI-anchored protein, is expressed on the majority of myeloid cells in bone marrow and peripheral granulocytes.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Ly-6G transfected EL-4J cell line.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

While 1A8 recognizes only Ly-6G, clone RB6-8C5 recognizes both Ly-6G and Ly-6C. Clone RB6-8C5 binds with high affinity to mouse Ly-6G molecules and to a lower extent to Ly-6C15. Clone RB6-8C5 impairs the binding of anti-mouse Ly-6G clone 1A815. However, clone RB6-8C5 is able to stain in the presence of anti-mouse Ly-6C clone HK1.416.

Additional reported applications (for the relevant formats) include: immunohistochemistry9 of frozen sections10 and paraffin-embedded sections11, depletion4, 12-14, and spatial biology (IBEX)20,21. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for in vivo studies or highly sensitive assays (Cat. No. 127632, 127649, 127650, 127661 and 127662).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Fleming TJ, et al. 1993. J. Immunol. 151:2399. (FC)
  2. Daley JM, et al. 2008. J. Leukocyte Biol. 83:1. (FC)
  3. Dietlin TA, et al. 2007. J. Leukocyte Biol. 81:1205. (FC)
  4. Daley J, et al. 2007. J. Leukocyte Biol. doi:10.1189. (Deplete) PubMed
  5. Tadagavadi RK, et al. 2010. J. Immunol. 185:4904. PubMed
  6. Sumagin R, et al. 2010. J. Immunol. 185:7057. PubMed
  7. Guiducci C, et al. 2010. J. Exp Med. 207:2931. PubMed
  8. Fujita M, et al. 2011. Cancer Res. 71:2664. PubMed
  9. Van Leeuwen, et al. 2008. Arterioscler. Thromb. Vasc. Biol. 28:84. (IHC)
  10. Kowanetz M, et al. 2010. P. Natl. Acad. Sci. USA 107:21248. [supplementary data] (IHC)
  11. Esbona K, et al. 2016. Breast Cancer Res. 18:35. (IHC)
  12. Wojtasiak M, et al. 2010. J. Gen. Virol. 91:2158. (FC, Deplete)
  13. Jaeger BN, et al. 2012. J. Exp. Med. 209:565. (Deplete)
  14. Wozniak KL, et al. 2012. BMC Immunol. 13:65 (FC, Deplete)
  15. Ribechini E, et al. 2009. Eur. J. Immunol. 39:3538.
  16. Ng LG, et al. 2011. J Invest. Dermatol. 131:2058. PubMed
  17. Ma C, et al. 2012. J. Leukoc. Biol. 92:1199.
  18. McCartney-Francis, N, et al. 2014. J Leukoc. Biol. 96:917. PubMed
  19. Her Z, et al. 2014. EMBO Mol. Med. 7:24. PubMed
  20. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  21. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
Product Citations
  1. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  2. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  3. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  4. Guilliams M, et al. 2022. Cell. 185:379. PubMed
  5. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
  6. Pisu D, et al. 2021. J Exp Med. 218:. PubMed
RRID
AB_2749962 (BioLegend Cat. No. 127655)

Antigen Details

Structure
A 21-35 kD GPI-anchorded membrane protein
Distribution

Expressed on the majority of myeloid cells in bone marrow and peripheral granulocytes. The monoclonal antibody RB6-8C5 recognizes both Ly-6G and Ly-6C.

Cell Type
Granulocytes, Macrophages, Monocytes
Biology Area
Immunology, Innate Immunity
Antigen References

Fleming TJ, et al. 1993. J. Immunol. 151:2399.

Gene ID
546644 View all products for this Gene ID
UniProt
View information about Ly-6G on UniProt.org

Other Formats

View All Ly-6G Reagents Request Custom Conjugation
Description Clone Applications
Alexa Fluor® 594 anti-mouse Ly-6G 1A8 IHC-F,SB
Purified anti-mouse Ly-6G 1A8 FC,IHC-F,IHC-P,SB
Biotin anti-mouse Ly-6G 1A8 FC,IHC
FITC anti-mouse Ly-6G 1A8 FC
PE anti-mouse Ly-6G 1A8 FC
Alexa Fluor® 647 anti-mouse Ly-6G 1A8 FC,IHC-F,SB
Pacific Blue™ anti-mouse Ly-6G 1A8 FC
APC anti-mouse Ly-6G 1A8 FC
PerCP/Cyanine5.5 anti-mouse Ly-6G 1A8 FC
PE/Cyanine7 anti-mouse Ly-6G 1A8 FC
Alexa Fluor® 700 anti-mouse Ly-6G 1A8 FC,IHC
APC/Cyanine7 anti-mouse Ly-6G 1A8 FC
Alexa Fluor® 488 anti-mouse Ly-6G 1A8 FC,IHC-F,SB
Brilliant Violet 421™ anti-mouse Ly-6G 1A8 FC,IHC-F
Brilliant Violet 570™ anti-mouse Ly-6G 1A8 FC
Ultra-LEAF™ Purified anti-mouse Ly-6G 1A8 FC,Depletion,IHC
Brilliant Violet 510™ anti-mouse Ly-6G 1A8 FC
Purified anti-mouse Ly-6G (Maxpar® Ready) 1A8 FC,CyTOF®,WB
Brilliant Violet 650™ anti-mouse Ly-6G 1A8 FC
Brilliant Violet 711™ anti-mouse Ly-6G 1A8 FC
Brilliant Violet 605™ anti-mouse Ly-6G 1A8 FC
Brilliant Violet 785™ anti-mouse Ly-6G 1A8 FC
PE/Dazzle™ 594 anti-mouse Ly-6G 1A8 FC
APC/Fire™ 750 anti-mouse Ly-6G 1A8 FC
PerCP anti-mouse Ly-6G 1A8 FC
TotalSeq™-A0015 anti-mouse Ly-6G 1A8 PG
TotalSeq™-C0015 anti-mouse Ly-6G 1A8 PG
TotalSeq™-B0015 anti-mouse Ly-6G 1A8 PG
Spark Blue™ 550 anti-mouse Ly-6G 1A8 FC
Spark NIR™ 685 anti-mouse Ly-6G 1A8 FC
Spark YG™ 593 anti-mouse Ly-6G 1A8 FC
APC/Fire™ 810 anti-mouse Ly-6G Antibody 1A8 FC
PE/Cyanine5 anti-mouse Ly-6G 1A8 FC
PE/Fire™ 810 anti-mouse Ly-6G Antibody 1A8 FC
Spark UV™ 387 anti-mouse Ly-6G 1A8 FC
PE/Fire™ 640 anti-mouse Ly-6G 1A8 FC
Spark YG™ 570 anti-mouse Ly-6G 1A8 IHC-F,FC
Spark Red™ 718 anti-mouse Ly-6G (Flexi-Fluor™) 1A8 FC
Spark Blue™ 574 anti-mouse Ly-6G (Flexi-Fluor™) 1A8 FC
Go To Top Version: 1    Revision Date: 07/18/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account