TotalSeq™-A0098 anti-mouse CD135 Antibody

Pricing & Availability
Clone
A2F10 (See other available formats)
Regulatory Status
RUO
Other Names
Flk-2, Flt3, Ly-72
Isotype
Rat IgG2a, κ
Barcode Sequence
GTAGCAAGATTCAAG
Compare all formats
Cat # Size Price Quantity Check Availability
135316 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD135, also known as Flk-2, Flt3, and Ly-72, is a type III tyrosine kinase receptor. It is expressed on early B lymphoid lineage cells in bone marrow, on primitive myeloid progenitors within the BM CD34+ cell population. Ligation of Flk-2 with Flt3 ligand regulates the growth of hematopoietic stem cells and promotes the survival of primitive hematopoietic progenitor cells with myeloid as well as B lymphoid potential. It was reported that the receptor tyrosine kinase Flt3 is required for dendritic cell development. Combined signaling through interleukin-7 receptors and Flt3 selectively promotes B-cell commitment and differentiation from uncommitted murine bone marrow progenitor cells.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse Flt3 transfected cell line
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Sergejeva S, et al. 2004. Blood 103:1270.
  2. Auffray C, et al. 2009. J. Exp. Med. 206:595.
  3. Chiba H, et al. 2013. Am J Physiol Cell Physiol. 305:693. PubMed
Product Citations
  1. Donado CA, et al. 2020. Cell Reports. 31(1):107466. PubMed
  2. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  3. Zhong X, et al. 2020. Proc Natl Acad Sci U S A. 8563:117. PubMed
  4. Wagner AK, et al. 2017. Nat Commun. 8:15627. PubMed
RRID
AB_2749983 (BioLegend Cat. No. 135316)

Antigen Details

Structure
A 135-150 kD molecule belonging to the tyrosine kinase receptor family.
Distribution

Expressed on early B lymphoid lineage cells in juvenile and adult bone marrow, primitive myeloid progenitors within the BM CD34+ cell population.

Function
Regulate the growth of hematopoietic stem cells and promote the survival of primitive hematopoietic progenitor cells.
Ligand/Receptor
Flk-2/FLT3 ligand
Cell Type
B cells, Hematopoietic stem and progenitors
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Waskow C, et al.Nat. Immunol. 9:676
2. Veiby OP, et al. 1996. Blood 88(4):1256
3. Veiby OP, et al. 1996. J. Immunol. 157(7):2953
4. Mattews W, et al. 1991. Cell. 65(7):1143
5. Hannum C, et al. 1994. Nature 368(2):643
6. Ogawa M, et al. 1998. Exp Hematol. 26(6):478

Gene ID
14255 View all products for this Gene ID
UniProt
View information about CD135 on UniProt.org
Go To Top Version: 1    Revision Date: 07/13/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account