- Clone
- TER-119 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Ly-76
- Isotype
- Rat IgG2b, κ
- Barcode Sequence
- GCGCGTTTGTGCTAT
| Cat # | Size | Price | Quantity Check Availability | ||
|---|---|---|---|---|---|
| 116247 | 10 µg | $369.00 | |||
The TER-119 antigen is a 52 kD glycophorin A-associated protein, also known as Ly-76. TER-119 is an erythroid-specific antigen expressed on early proerythroblasts to mature erythrocytes, but not on erythroid colony-forming cells (BFU-E, blast-forming unit erythroid, or CFU-E, colony-forming unit erythroid).
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Day-14 fetal liver cells from a C57BL/6 mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The TER-119 antibody is useful for distinguishing erythrocytes and cells in the erythroid lineage. Additional reported applications (for the relevant formats) include: immunoprecipitation1, Western blotting1, complement-mediated cytotoxicity3, and immunohistochemical staining of acetone-fixed frozen sections and formalin-fixed paraffin-embedded sections. Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 116253-116258).
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Kina T, et al. 2000. Br. J. Haematol. 109:280. (IP, WB)
- Vannucchi AM, et al. 2000. Blood 95:2559.
- Maraskovsky E, et al. 1996. J. Exp. Med. 184:1953. (CMCD)
- Grisendi S, et al. 2005. Nature 437:147. (FC)
- Bourdeau A, et al. 2007. Blood 109:4220.
- Chappaz S, et al. 2007. Blood 110:3862. (FC)
- Heuser M, et al. 2007. Blood 110:1639. (FC)
- Gough SM, et al. 2014. Cancer Discov. 4:564. PubMed
- RRID
-
AB_2749989 (BioLegend Cat. No. 116247)
Antigen Details
- Structure
- Associated with glycophorin A, 52 kD
- Distribution
-
Early proerythroblast to mature erythrocyte, but not BFU-E and CFU-E
- Cell Type
- Erythrocytes
- Biology Area
- Immunology
- Antigen References
-
1. Kina T, et al. 2000. Br. J. Haematol. 109:280.
2. Ikuta K, et al. 1990. Cell 62:863.
3. Osawa M, et al. 1996. Weir's Handbook of Experimental Immunology. Vol. 2 pp. 66.1-66.5. - Gene ID
- 104231 View all products for this Gene ID
- UniProt
- View information about TER-119 on UniProt.org
Other Formats
View All TER-119 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells stained with TER-119 APC and anti-... -
Biotin anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells were stained with biotinylated TER... -
FITC anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells stained with TER-119 FITC and anti... -
PE anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells stained with TER-119 PE and anti-m... -
PE/Cyanine5 anti-mouse TER-119/Erythroid Cells
-
Purified anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells stained with TER-119 FITC and CD45... 
Fresh, frozen mouse spleen was stained with purified TER-119... -
Alexa Fluor® 488 anti-mouse TER-119/Erythroid Cells
C57BL/6 mouse bone marrow cells stained with TER119 Alexa Fl... -
Alexa Fluor® 647 anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells stained with TER-119 Alexa Fluor® ... -
Alexa Fluor® 700 anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow stained cell with TER-119 Alexa Fluor&re... -
PE/Cyanine7 anti-mouse TER-119/Erythroid Cells
C57BL/6 mouse bone marrow cells stained with TER119 PE/Cyani... -
APC/Cyanine7 anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells were stained with TER-119 APC/Cyan... -
PerCP anti-mouse TER-119/Erythroid Cells
C57BL/6 mouse bone marrow cells stained with TER-119 PerCP -
PerCP/Cyanine5.5 anti-mouse TER-119/Erythroid Cells
C57BL/6 mouse bone marrow cells stained with TER-119 PerCP/C... -
Brilliant Violet 421™ anti-mouse TER-119/Erythroid Cells
C57BL/6 splenocytes mixed with red blood cells were stained ... 
-
Pacific Blue™ anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells stained with Ter-119 Pacific Blue&... -
Brilliant Violet 650™ anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells were stained with CD45 PE and TER-... -
Brilliant Violet 510™ anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells were stained with CD45 Pacific Blu... 
-
Brilliant Violet 605™ anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells were stained with CD45 FITC and TE... 
-
Purified anti-mouse TER-119/Erythroid Cells (Maxpar® Ready)
C57BL/6 mouse splenocytes mixed with red blood cells and sta... -
PE/Dazzle™ 594 anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells were stained with CD45 APC and TER... 
-
Brilliant Violet 785™ anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells were stained with CD45 FITC and TE... -
TotalSeq™-A0122 anti-mouse TER-119/Erythroid Cells
-
APC/Fire™ 750 anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells were stained with CD45 FITC and TE... -
TotalSeq™-B0122 anti-mouse TER-119/Erythroid Cells
-
TotalSeq™-C0122 anti-mouse TER-119/Erythroid Cells
-
Ultra-LEAF™ Purified anti-mouse TER-119/Erythroid Cells
-
Spark Blue™ 550 anti-mouse TER-119/Erythroid Cells
C57BL/6 mouse bone marrow cells stained with CD45 PE and Ter... -
APC/Fire™ 810 anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow were stained with CD45 PE and TER-119 (c... -
Spark NIR™ 685 anti-mouse TER-119/Erythroid Cells Antibody
C57BL/6 mouse bone marrow cells were stained with anti-mouse... -
Brilliant Violet 711™ anti-mouse TER-119/Erythroid Cells
C57BL/6 bone marrow cells were stained with anti-mouse CD45 ... -
Spark Red™ 718 anti-mouse TER-119/Erythroid Cells (Flexi-Fluor™)
-
Spark Blue™ 574 anti-mouse TER-119/Erythroid Cells (Flexi-Fluor™)