TotalSeq™-A0122 anti-mouse TER-119/Erythroid Cells Antibody

Pricing & Availability
Clone
TER-119 (See other available formats)
Regulatory Status
RUO
Other Names
Ly-76
Isotype
Rat IgG2b, κ
Barcode Sequence
GCGCGTTTGTGCTAT
Cat # Size Price Quantity Check Availability
116247 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The TER-119 antigen is a 52 kD glycophorin A-associated protein, also known as Ly-76. TER-119 is an erythroid-specific antigen expressed on early proerythroblasts to mature erythrocytes, but not on erythroid colony-forming cells (BFU-E, blast-forming unit erythroid, or CFU-E, colony-forming unit erythroid).

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Day-14 fetal liver cells from a C57BL/6 mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The TER-119 antibody is useful for distinguishing erythrocytes and cells in the erythroid lineage. Additional reported applications (for the relevant formats) include: immunoprecipitation1, Western blotting1, complement-mediated cytotoxicity3, and immunohistochemical staining of acetone-fixed frozen sections and formalin-fixed paraffin-embedded sections. Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 116253-116258).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Kina T, et al. 2000. Br. J. Haematol. 109:280. (IP, WB)
  2. Vannucchi AM, et al. 2000. Blood 95:2559.
  3. Maraskovsky E, et al. 1996. J. Exp. Med. 184:1953. (CMCD)
  4. Grisendi S, et al. 2005. Nature 437:147. (FC)
  5. Bourdeau A, et al. 2007. Blood 109:4220.
  6. Chappaz S, et al. 2007. Blood 110:3862. (FC)
  7. Heuser M, et al. 2007. Blood 110:1639. (FC)
  8. Gough SM, et al. 2014. Cancer Discov. 4:564. PubMed
RRID
AB_2749989 (BioLegend Cat. No. 116247)

Antigen Details

Structure
Associated with glycophorin A, 52 kD
Distribution

Early proerythroblast to mature erythrocyte, but not BFU-E and CFU-E

Cell Type
Erythrocytes
Biology Area
Immunology
Antigen References

1. Kina T, et al. 2000. Br. J. Haematol. 109:280.
2. Ikuta K, et al. 1990. Cell 62:863.
3. Osawa M, et al. 1996. Weir's Handbook of Experimental Immunology. Vol. 2 pp. 66.1-66.5.

Gene ID
104231 View all products for this Gene ID
UniProt
View information about TER-119 on UniProt.org

Other Formats

View All TER-119 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-mouse TER-119/Erythroid Cells TER-119 FC
Biotin anti-mouse TER-119/Erythroid Cells TER-119 FC
FITC anti-mouse TER-119/Erythroid Cells TER-119 FC
PE anti-mouse TER-119/Erythroid Cells TER-119 FC
PE/Cyanine5 anti-mouse TER-119/Erythroid Cells TER-119 FC
Purified anti-mouse TER-119/Erythroid Cells TER-119 FC,IHC-F,IHC-P,IP,WB
Alexa Fluor® 488 anti-mouse TER-119/Erythroid Cells TER-119 FC
Alexa Fluor® 647 anti-mouse TER-119/Erythroid Cells TER-119 FC
Alexa Fluor® 700 anti-mouse TER-119/Erythroid Cells TER-119 FC
PE/Cyanine7 anti-mouse TER-119/Erythroid Cells TER-119 FC
APC/Cyanine7 anti-mouse TER-119/Erythroid Cells TER-119 FC
PerCP anti-mouse TER-119/Erythroid Cells TER-119 FC
PerCP/Cyanine5.5 anti-mouse TER-119/Erythroid Cells TER-119 FC
Brilliant Violet 421™ anti-mouse TER-119/Erythroid Cells TER-119 FC
Pacific Blue™ anti-mouse TER-119/Erythroid Cells TER-119 FC
Brilliant Violet 650™ anti-mouse TER-119/Erythroid Cells TER-119 FC
Brilliant Violet 510™ anti-mouse TER-119/Erythroid Cells TER-119 FC
Brilliant Violet 605™ anti-mouse TER-119/Erythroid Cells TER-119 FC
Purified anti-mouse TER-119/Erythroid Cells (Maxpar® Ready) TER-119 FC,CyTOF®
PE/Dazzle™ 594 anti-mouse TER-119/Erythroid Cells TER-119 FC
Brilliant Violet 785™ anti-mouse TER-119/Erythroid Cells TER-119 FC
TotalSeq™-A0122 anti-mouse TER-119/Erythroid Cells TER-119 PG
APC/Fire™ 750 anti-mouse TER-119/Erythroid Cells TER-119 FC
TotalSeq™-B0122 anti-mouse TER-119/Erythroid Cells TER-119 PG
TotalSeq™-C0122 anti-mouse TER-119/Erythroid Cells TER-119 PG
Ultra-LEAF™ Purified anti-mouse TER-119/Erythroid Cells TER-119 FC,IHC-F,IHC-P,IP,WB,CMCD
Spark Blue™ 550 anti-mouse TER-119/Erythroid Cells TER-119 FC
APC/Fire™ 810 anti-mouse TER-119/Erythroid Cells TER-119 FC
Spark NIR™ 685 anti-mouse TER-119/Erythroid Cells Antibody TER-119 FC
Brilliant Violet 711™ anti-mouse TER-119/Erythroid Cells TER-119 FC
Spark Red™ 718 anti-mouse TER-119/Erythroid Cells (Flexi-Fluor™) TER-119 FC
Spark Blue™ 574 anti-mouse TER-119/Erythroid Cells (Flexi-Fluor™) TER-119 FC
Go To Top Version: 1    Revision Date: 07/12/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account