- Clone
- RMM-1 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Immunoglobulin M
- Isotype
- Rat IgG2a, κ
- Barcode Sequence
- AGCTACGCATTCAAT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
406535 | 10 µg | $369.00 |
IgM is the first immunoglobulin made by B cells in the immune response. Surface IgM is expressed on the majority of mature B cells.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Mouse Ig cocktail
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The RMM-1 antibody reacts with both soluble and membrane immunoglobulin M in all tested mouse haplotypes (Igh-a and b). It does not react with other isotypes. Some formats of the RMM-1 antibody may be used as primary or secondary reagent for immunofluorescent staining or ELISA analysis.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Tertilt C, et al. 2009. Infect. Immun. 77:3044. (ELISA) PubMed
- Product Citations
-
- RRID
-
AB_2783322 (BioLegend Cat. No. 406535)
Antigen Details
- Structure
- Ig family
- Distribution
-
B cells
- Function
- B cell differentiation, humoral immune response; cross-linking surface IgM induces apoptosis
- Cell Type
- B cells
- Biology Area
- Immunology
- Gene ID
- 16019 View all products for this Gene ID
- UniProt
- View information about IgM on UniProt.org
Other Formats
View All IgM Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-mouse IgM | RMM-1 | FC,ELISA |
PE anti-mouse IgM | RMM-1 | FC |
Biotin anti-mouse IgM | RMM-1 | ELISA,FC |
FITC anti-mouse IgM | RMM-1 | FC |
APC anti-mouse IgM | RMM-1 | FC |
PerCP/Cyanine5.5 anti-mouse IgM | RMM-1 | FC |
APC/Cyanine7 anti-mouse IgM | RMM-1 | FC |
Brilliant Violet 421™ anti-mouse IgM | RMM-1 | FC |
PE/Cyanine7 anti-mouse IgM | RMM-1 | FC |
Alexa Fluor® 488 anti-mouse IgM | RMM-1 | FC |
Brilliant Violet 605™ anti-mouse IgM | RMM-1 | FC |
Alexa Fluor® 647 anti-mouse IgM | RMM-1 | FC |
Purified anti-mouse IgM (Maxpar® Ready) | RMM-1 | FC,CyTOF® |
PE/Dazzle™ 594 anti-mouse IgM | RMM-1 | FC |
Brilliant Violet 510™ anti-mouse IgM | RMM-1 | FC |
TotalSeq™-A0450 anti-mouse IgM | RMM-1 | PG |
Brilliant Violet 711™ anti-mouse IgM | RMM-1 | FC |
APC/Fire™ 750 anti-mouse IgM | RMM-1 | FC |
TotalSeq™-C0450 anti-mouse IgM | RMM-1 | PG |
PE/Cyanine5 anti-mouse IgM | RMM-1 | FC |
TotalSeq™-B0450 anti-mouse IgM | RMM-1 | PG |
Spark Violet™ 423 anti-mouse IgM | RMM-1 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-mouse IgM
-
PE anti-mouse IgM
-
Biotin anti-mouse IgM
-
FITC anti-mouse IgM
-
APC anti-mouse IgM
-
PerCP/Cyanine5.5 anti-mouse IgM
-
APC/Cyanine7 anti-mouse IgM
-
Brilliant Violet 421™ anti-mouse IgM
-
PE/Cyanine7 anti-mouse IgM
-
Alexa Fluor® 488 anti-mouse IgM
-
Brilliant Violet 605™ anti-mouse IgM
-
Alexa Fluor® 647 anti-mouse IgM
-
Purified anti-mouse IgM (Maxpar® Ready)
-
PE/Dazzle™ 594 anti-mouse IgM
-
Brilliant Violet 510™ anti-mouse IgM
-
TotalSeq™-A0450 anti-mouse IgM
-
Brilliant Violet 711™ anti-mouse IgM
-
APC/Fire™ 750 anti-mouse IgM
-
TotalSeq™-C0450 anti-mouse IgM
-
PE/Cyanine5 anti-mouse IgM
-
TotalSeq™-B0450 anti-mouse IgM
-
Spark Violet™ 423 anti-mouse IgM