- Clone
- HK1.4 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Lymphocyte antigen 6 complex, locus C
- Isotype
- Rat IgG2c, κ
- Barcode Sequence
- AAGTCGTGAGGCATG
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
128047 | 10 µg | $369.00 |
Most hematopoietic cells express one or more members of Ly-6 family. The expression of Ly-6 varies with development stage and activation. Ly-6C is a 14-17 kD GPI-linked surface protein expressed on mouse monocyte/macrophage cells, endothelial cells, neutrophils, and some T cell subsets. Ly-6C is reported to be an indicator of memory CD8+ T cells.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- L3 cloned CTL cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone HK1.4 does not block the binding of clone RB6-8C58.
Additional reported applications (for relevant formats of this clone) include: in vitro activation of T cells1-3 and immunohistochemistry of frozen sections4. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Jutila MA, et al. 1988. Eur. J. Immunol. 18:1819. (Activ)
- Herold KC, et al. 1990. Diabetes 39:815. (Activ)
- Havran WL, et al. 1988. J. Immunol. 140:1034 (Activ)
- Flanagan K, et al. 2008. J. Immunol. 180:3874. (IHC)
- Makaroff LE, et al. 2009. P. Natl. Acad. Sci. USA 106:4799. (FC)
- Zuber J, et al. 2009. Genes Dev. 23:877. (FC) PubMed
- Ribechini E, et al. 2009. Eur. J. Immunol. 39:3538.
- Ma C, et al. 2012. J. Leukoc. Biol. 92:1199.
- Watson NB, et al. 2015. J Immunol. 194:2796. PubMed
- Product Citations
-
- RRID
-
AB_2749961 (BioLegend Cat. No. 128047)
Antigen Details
- Structure
- 14-17 kD protein (134 amino acids), member of the Ly-6 family of GPI linked protein. Ly6 family members share structure homology throughout a distinctive cystein rich protein domain that incorporates O-linked carbohydrates.
- Distribution
-
Ly-6C is expressed primarily on bone marrow myeloid populations, monocytes/macrophages, neutrophils, endothelial cells, and some T cell subsets. Ly-6C is also a marker of memory CD8+ T cells.
- Cell Type
- Endothelial cells, Macrophages, Monocytes, Neutrophils, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Jutila MA, et al. 1988. Eur. J. Immunol. 18:1819.
2. Cerwenka A, et al. 1998. J. Immunol. 161:97. - Gene ID
- 17067 View all products for this Gene ID
- UniProt
- View information about Ly-6C on UniProt.org
Other Formats
View All Ly-6C Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Pacific Blue™ anti-mouse Ly-6C
-
APC anti-mouse Ly-6C
-
Purified anti-mouse Ly-6C
-
Biotin anti-mouse Ly-6C
-
FITC anti-mouse Ly-6C
-
Alexa Fluor® 647 anti-mouse Ly-6C
-
PE anti-mouse Ly-6C
-
PerCP/Cyanine5.5 anti-mouse Ly-6C
-
PE/Cyanine7 anti-mouse Ly-6C
-
Alexa Fluor® 488 anti-mouse Ly-6C
-
Alexa Fluor® 700 anti-mouse Ly-6C
-
APC/Cyanine7 anti-mouse Ly-6C
-
PerCP anti-mouse Ly-6C
-
Brilliant Violet 570™ anti-mouse Ly-6C
-
Brilliant Violet 421™ anti-mouse Ly-6C
-
Brilliant Violet 510™ anti-mouse Ly-6C
-
Brilliant Violet 605™ anti-mouse Ly-6C
-
Brilliant Violet 711™ anti-mouse Ly-6C
-
Purified anti-mouse Ly-6C (Maxpar® Ready)
-
Brilliant Violet 785™ anti-mouse Ly-6C
-
PE/Dazzle™ 594 anti-mouse Ly-6C
-
APC/Fire™ 750 anti-mouse Ly-6C
-
TotalSeq™-A0013 anti-mouse Ly-6C
-
Brilliant Violet 650™ anti-mouse Ly-6C
-
TotalSeq™-C0013 anti-mouse Ly-6C
-
TotalSeq™-B0013 anti-mouse Ly-6C
-
APC/Fire™ 810 anti-mouse Ly-6C Antibody
-
Spark UV™ 387 anti-mouse Ly-6C
-
PE/Fire™ 810 anti-mouse Ly-6C
-
Spark Blue™ 550 anti-mouse Ly-6C (Flexi-Fluor™)
-
Spark Blue™ 574 anti-mouse Ly-6C (Flexi-Fluor™)