TotalSeq™-A0013 anti-mouse Ly-6C Antibody

Pricing & Availability
Clone
HK1.4 (See other available formats)
Regulatory Status
RUO
Other Names
Lymphocyte antigen 6 complex, locus C
Isotype
Rat IgG2c, κ
Barcode Sequence
AAGTCGTGAGGCATG
Compare all formats
Cat # Size Price Quantity Check Availability
128047 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Most hematopoietic cells express one or more members of Ly-6 family. The expression of Ly-6 varies with development stage and activation. Ly-6C is a 14-17 kD GPI-linked surface protein expressed on mouse monocyte/macrophage cells, endothelial cells, neutrophils, and some T cell subsets. Ly-6C is reported to be an indicator of memory CD8+ T cells.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
L3 cloned CTL cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone HK1.4 does not block the binding of clone RB6-8C58.

Additional reported applications (for relevant formats of this clone) include: in vitro activation of T cells1-3 and immunohistochemistry of frozen sections4.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Jutila MA, et al. 1988. Eur. J. Immunol. 18:1819. (Activ)
  2. Herold KC, et al. 1990. Diabetes 39:815. (Activ)
  3. Havran WL, et al. 1988. J. Immunol. 140:1034 (Activ)
  4. Flanagan K, et al. 2008. J. Immunol. 180:3874. (IHC)
  5. Makaroff LE, et al. 2009. P. Natl. Acad. Sci. USA 106:4799. (FC)
  6. Zuber J, et al. 2009. Genes Dev. 23:877. (FC) PubMed
  7. Ribechini E, et al. 2009. Eur. J. Immunol. 39:3538.
  8. Ma C, et al. 2012. J. Leukoc. Biol. 92:1199.
  9. Watson NB, et al. 2015. J Immunol. 194:2796. PubMed
Product Citations
  1. Lin YH 2023. Immunity. 56(1):207-223.e8. PubMed
  2. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  3. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  4. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  5. Guilliams M, et al. 2022. Cell. 185:379. PubMed
  6. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
RRID
AB_2749961 (BioLegend Cat. No. 128047)

Antigen Details

Structure
14-17 kD protein (134 amino acids), member of the Ly-6 family of GPI linked protein. Ly6 family members share structure homology throughout a distinctive cystein rich protein domain that incorporates O-linked carbohydrates.
Distribution

Ly-6C is expressed primarily on bone marrow myeloid populations, monocytes/macrophages, neutrophils, endothelial cells, and some T cell subsets. Ly-6C is also a marker of memory CD8+ T cells.

Cell Type
Endothelial cells, Macrophages, Monocytes, Neutrophils, T cells
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Jutila MA, et al. 1988. Eur. J. Immunol. 18:1819.
2. Cerwenka A, et al. 1998. J. Immunol. 161:97.

Gene ID
17067 View all products for this Gene ID
UniProt
View information about Ly-6C on UniProt.org
Go To Top Version: 1    Revision Date: 07/12/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account